Coexistence and population genetic structure of the whooper swan Cygnus cygnus and mute swan Cygnus olor in Lithuania and Latvia

Abstract

Coexistence and population genetic structure of the whooper swan Cygnus cygnus and mute swan Cygnus olor in Lithuania and Latvia IntroductionCoexistence between closely related species in a given habitat or region has been of interest to researchers for decades [1][2][3][4]. Species with diverse population structures are generally better adapted to changing environmental conditions and can more successfully utilize new types of habitats [5]. As a result of global environmental change, closely related species that were historically separated by geographic barriers are sometimes found to coexist, which can result in an increase in interactions such as competition and hybridization. Two closely related swan species, the mute swan Cygnus olor and the whooper swan Cygnus cygnus were formerly allopatric throughout their breeding ranges, but during the last decades their breeding ranges have overlapped in the Baltic Sea Region [6][7][8]. This range overlap was caused by a rapid expansion in the breeding range of both species in Europe. In Lithuania and Latvia both species presently occur in the same type of habitats.The whooper swan is a characteristic species of the boreal zone in Europe. It was pushed close to extinction in the Baltic region during the 19 th and the early 20 th century due to intense human persecution [6]. A rapid range expansion of the species has been recorded since the 1970s (mainly due to improved conservation measures) and during the past decades it has established as a breeding species in all countries of the Baltic region. In Sweden, the number of whooper swans has increased from 20 pairs in the early 20 th century to about 5.400 pairs estimated during the last few years [9]. Similarly in Finland, a recorded 15 pairs from the 1940s have increased to 5.000-7.000 pairs during the last decade [10]. An increase in the number of the breeding birds was also recorded in other countries of Central and Western Europe [11][12][13][14][15][16]. The species continues to spread southwards, re-occupying former nesting grounds. During the same period, since the Keywords: Cygnus cygnus • Cygnus olor • D-loop • population genetic structure • CoexistenceAbstract: Two closely related swan species, the mute swan Cygnus olor and the whooper swan Cygnus cygnus, were formerly allopatric throughout their breeding ranges, but during the last decades a sympatric distribution has become characteristic of these species in the Baltic Sea region. The whooper swan has gradually replaced the mute swan in many suitable habitats in Lithuania and Latvia. Marked differences in the genetic population structure of both species may partially explain the dominance of the whooper swan, as genetic population divergence can be a major factor affecting inter-specific competition. A homogenous genetic population structure was defined for mute swans breeding in Lithuania, Latvia, Poland and Belarus. Breeding mute swans in this region are mostly of naturalised origin. A diverse population genetic structure characterizes whooper swans bree...

Genetic Diversity of Mute Swan Population of the Riga Urban Area

“…The three primers used allowed to separate the majority of individuals studied. Our findings disagree with results of a study by Butkauskas et al (2012) based on partial mitochondrial D-loop sequences, as they found only one haplotype in mute swans breeding and wintering in Latvia and Lithuania suggesting monotypic genetic structure. This discrepancy might be explained by the different methods used: in the study of Butkauskas et al (2012) diversity acquired via maternal inheritances was analysed, whereas our data involves nuclear variability of individuals.…”

Breeding population increase and range expansion of the Whooper Swan <em>Cygnus cygnus</em> in Oslo and Akershus

“…There have been particularly large increases after around 1985 (Axbrink 1999, Green & Lindström 2014, Nilsson 2014) which may be due to changes in agricultural practices that have favoured the Whooper Swan (Nilsson 2014). Similar increases have been observed in Finland (Valkama et al 2011), Estonia (Luigujoe et al 2002, Boiko et al 2014 and Latvia and Lithuania (Butkauskas et al 2012, Boiko et al 2014.…”

“…An important question is whether interactions between the two swan species may cause either a limitation of the population expansion of Whooper Swans in Oslo and Akershus, or a replacement of Mute Swans by Whooper Swans. In both Sweden (Svensson et al 1999) and Latvia and Lithuania (Butkauskas et al 2012) Whooper Swans have replaced Mute Swans in some areas. Although Whooper Swans rarely breed in saltwater where Mute Swans are common, and Whooper Swans do not have competition from Mute Swans at small lakes in forested areas, there is habitat overlap in particular at rich freshwater lakes (Gjershaug et al 1994, Svensson et al 1999.…”

Ancient DNA and morphometric analysis reveal extinction and replacement of New Zealand's unique black swans

“…DNA was extracted from bone samples using the Qiagen DNeasy Tissue Kit following the manufacturer's instructions with an overnight incubation at 558C. A 335 bp portion of the mitochondrial Control Region (CR) was amplified using the primer pair Cygn-1F (5 0 GGTTATGCATATTCGTGCATAGAT 3 0 )/ Cygn-3R (5 0 ACGTATGGGCCTGAAGCTAGT 3 0 ) [35]. Each PCR reaction (10 ml) consisted of: 0.4 mg ml 21 BSA, 0.75 mM MgCl 2 (Bioline), 1 Â PCR buffer (Bioline), 2.5 mM dNTPs (Bioline), 0.5 mM of each primer, 0.05 U Taq Polymerase (Bioline), and 1 ml DNA.…”