Coeliac Disease among Healthy Members of Multiple Case Coeliac Disease Families

Mustalahti, K.; Sulkanen, Satu; Holopainen, Päivi; Laurila, Kaija; Collin, Pekka; Partanen, Jukka; Mäki, Markku

doi:10.1080/003655202753416812

Cited by 51 publications

(38 citation statements)

References 28 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The recruitment and clinical findings have been published elsewhere. 46 Briefly, the earlier diagnoses were re-evaluated by scrutinising the medical records. Antibody screenings were performed to reveal the asymptomatic cases.…”

Section: Patientsmentioning

confidence: 99%

“…Three known polymorphisms within the CTLA4 gene were genotyped. Two dimorphisms, þ 49*A/G in the exon 1 46 and -318*C/T in the promoter region, 47 were typed by PCR/RFLP method, using primers 5 0 AACCC AGGTAGGAGAAACAC and 5 0 GCTCTACTTCCTGAA GACCT and BbvI digestion for CTLA4 þ 49*A/G, and primers 5 0 TTACGAGAAAGGAAGCCGTG and 5 0 AAA TGAATTGGACTGGATGGT and MseI digestion for CTLA4 þ 318*C/T. A polymorphic AT repeat, CTLA4(AT)n, in the 3 0 -untranslated region of CTLA4 gene 48 was genotyped with fluorescent-labelled forward primer 5 0 GTGATGCTAAAGGTTGTATTGC and reverse primer 5 0 AAAACATACGTGGCTCTATGCAC using ABI PRISM 310 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA).…”

Section: Patientsmentioning

confidence: 99%

See 1 more Smart Citation

Genetic association of coeliac disease susceptibility to polymorphisms in the ICOS gene on chromosome 2q33

et al. 2004

View full text Add to dashboard Cite

An interesting candidate gene region for coeliac disease (CD), a common multifactorial disease, is a segment on 2q33-37 harbouring the genes for the CD28, cytotoxic T-lymphocyte-associated antigen-4 (CTLA4), inducible costimulator (ICOS), and programmed death-1 (PD-1), all receptors that regulate lymphocyte activation. Several studies have suggested a role for this locus in immune-mediated diseases. To study further our previous finding of genetic linkage of this region to CD, we studied 25 polymorphic markers to identify the putative disease-associated polymorphism. Transmission/disequilibrium test in 106 Finnish families with CD indicated that only four polymorphisms, all located in the ICOS gene, showed evidence for genetic association. Strong linkage disequilibrium (LD), based on the analysis of 424 haplotypes, encompassed not only the associated ICOS markers but also many polymorphisms in the CTLA4 gene. Our results demonstrate that due to LD, it appears not easy to identify the genuine susceptibility factor in this region without larger multipopulation studies. Furthermore, the results did not support the evidence that polymorphisms in CTLA4 were the major susceptibility locus for CD.

show abstract

Section: Patientsmentioning

confidence: 99%

Section: Patientsmentioning

confidence: 99%

Genetic association of coeliac disease susceptibility to polymorphisms in the ICOS gene on chromosome 2q33

et al. 2004

View full text Add to dashboard Cite

show abstract

“…Current studies in the production of gluten free malt have, so far, only focused on sorghum 15 and buckwheat 46,47,[53][54][55][56][57] . In Europe, the prevalence of CD has been estimated to be 1 in 300 to 1 in 500 persons, but recent population-based screening studies 33 suggest that prevalence is as high as 1 in 100. Recent studies have shown that CD is as frequent in the United States as in Europe 13 .…”

Section: Introductionmentioning

confidence: 99%

The Use of Response Surface Methodology to Optimise Malting Conditions of Proso Millet (Panicum miliaceum L.) as a Raw Material for Gluten-Free Foods

Zarnkow¹,

Kessler²,

Burberg³

et al. 2007

Journal of the Institute of Brewing

View full text Add to dashboard Cite

Response surface methodology was used to investigate the influence of the three malting parameters, i.e. degree of steeping, germination time, and temperature on the quality of proso millet malt. Each predictor variable was tested at three levels. Germination times varied from 5, 6, and 7 days, degrees of steeping were 44, 48, and 52%, and germination temperatures were 16, 20, and 24°C. A set kilning temperature of 65°C was used for all malts. A series of malt quality parameters were investigated including extract, apparent attenuation limit, gelatinisation temperature, ␣-amylase activity, ␤-amylase activity, limit dextrinase activity, Kolbach index, ␣-amino nitrogen, viscosity, and colour. The optimal malting program was achieved after the fifth day of germination, 44% degree of steeping, and a 22°C steeping and germination temperature. The obtained values for the amylolytic and cytolytic attributes were 64.8% extract, 1.383 mPa × s viscosity, 76.0% apparent attenuation limit, 111 U /g ␣-amylase activity, and 102 U /g ␤-amylase activity.

show abstract

“…In order to evaluate whether the HLA DQ alleles determine the exact clinical outcome, we studied the allele distribution in 25 Finnish families in which one sibling had cCD and the other DH. These families were identified from 110 multiplex families with gluten sensitive enteropathy (Mustalahti et al 2002) collected for genetic analyses. To increase the number of patients we also addressed the same question using Hungarian case-control material.…”

Section: mentioning

confidence: 99%

“…The collection of the families has been described elsewhere (Mustalahti et al 2002). Briefly, the diagnoses were ensured by scrutinizing hospital records and all voluntary family members were screened for gliadin and endomysial antibodies.…”

Section: Finnish Materialsmentioning

confidence: 99%

Genetic dissection between coeliac disease and dermatitis herpetiformis in sib pairs

Karell

Korponay-Szabó

et al. 2002

Annals of Human Genetics

Self Cite

View full text Add to dashboard Cite

Gluten sensitive enteropathy has various manifestations, of which the two major forms are classical coeliac disease (cCD) and dermatitis herpetiformis (DH). In cCD predominantly the small intestine is affected, whereas in DH also the skin is affected showing typical rash and IgA deposits. The symptoms in both forms are dependent on gluten intake. The factors diversifying these two clinical outcomes are unknown. In the present report we evaluated the role of the major genetic susceptibility locus, HLA DQ, in 25 families, in which both forms of the disease, cCD and DH, occurred in siblings. By using the family-based approach it can be assumed that within each family variation in environmental factors is substantially lower than in the standard case-control setting, and also the problems related to population stratification can be avoided. Results from the Finnish family material with 25 discordant and 85 concordant sib pairs, and from additional case-control material comprising 71 unrelated Hungarian DH and 68 cCD patients, together indicated that the HLA DQ locus did not differ between the two major outcomes of gluten sensitive enteropathy. The non-HLA DR ; DQ factors are critical for the different clinical manifestations of gluten sensitivity.

show abstract

Coeliac Disease among Healthy Members of Multiple Case Coeliac Disease Families

Cited by 51 publications

References 28 publications

Genetic association of coeliac disease susceptibility to polymorphisms in the ICOS gene on chromosome 2q33

Genetic association of coeliac disease susceptibility to polymorphisms in the ICOS gene on chromosome 2q33

The Use of Response Surface Methodology to Optimise Malting Conditions of Proso Millet (Panicum miliaceum L.) as a Raw Material for Gluten-Free Foods

Genetic dissection between coeliac disease and dermatitis herpetiformis in sib pairs

Contact Info

Product

Resources

About