Co-regulatory activity of hnRNP K and NS1-BP in influenza and human mRNA splicing

Abstract

Three of the eight RNA segments encoded by the influenza A virus (IAV) undergo alternative splicing to generate distinct proteins. Previously, we found that host proteins hnRNP K and NS1-BP regulate IAV M segment splicing, but the mechanistic details were unknown. Here we show NS1-BP and hnRNP K bind M mRNA downstream of the M2 5′ splice site (5′ss). NS1-BP binds most proximal to the 5′ss, partially overlapping the U1 snRNP binding site, while hnRNP K binds further downstream and promotes U1 snRNP recruitment. Mutation of either or both the hnRNP K and NS1-BP-binding sites results in M segment mis-splicing and attenuated IAV replication. Additionally, we show that hnRNP K and NS1-BP regulate host splicing events and that viral infection causes mis-splicing of some of these transcripts. Therefore, our proposed mechanism of hnRNP K/NS1-BP mediated IAV M splicing provides potential targets of antiviral intervention and reveals novel host functions for these proteins.

Viral-Induced Alternative Splicing of Host Genes Promotes Influenza Replication

“…Splicing changes that occur in response to hnRNP K knockdown were quantified using MAJIQ, filtering for significant changes of 10% or more in percent splicing (ΔPSI). In agreement with previous studies, we observe large changes in host splicing upon hnRNP K depletion ( Supplementary Table S2 )(Thompson et al, 2018; Venables et al, 2008). Importantly, 21% of the influenza-induced splicing changes are also hnRNP K-responsive ( Fig.…”

“…Therefore, we first tested if hnRNP K is important for IAV replication independent of its regulation of M segment splicing. In previous work, we generated an IAV mutant strain in which hnRNP K cannot bind to the M segment to regulate splicing (ΔK-mut; (Thompson et al, 2018). To determine if hnRNP K regulates IAV replication in the context of this virus, we depleted hnRNP K in A549 cells using siRNAs and assayed infectious virus particles 48 hours post-infection.…”

“…Notably, hnRNP K undergoes increased sequestration into nuclear speckles upon viral infection, suggesting that this may functionally deplete this protein from host genes that are typically spliced outside of speckles. HnRNP K was previously established to be important for IAV M segment splicing regulation (Mor et al, 2016; Thompson et al, 2018; Tsai et al, 2013). However, IAV replication is sensitive to hnRNP K expression even in the context of a mutant IAV in which hnRNP K is not required for M segment splicing regulation, consistent with hnRNP K regulating important pro-viral splicing events in host genes ( Fig.…”

“…For knockdown of hnRNP K to test viral replication (Fig. 5a), A549 cells were treated with 50 nM siRNA (Dharmacon, SMARTpool, M-011692-00) as previously described (Thompson et al, 2018). For RNA-Seq and validation experiments, hnRNP K was stably depleted from A549 cells using a lentiviral expressed doxycycline-inducible shRNA with sequence: agcg GGACCTATTATTACTACACAA TAGTGAAGCCACAGATGTATTGTGTAGTAATAATAGGTCC (target underlined) This shRNA vector and its use are described in detail previously (Martinez et al, 2015).…”

The dynamic proteome of influenza A virus infection identifies M segment splicing as a host range determinant

“…Moreover, differences in the binding specificity of viral hemagglutinins (HA) are known to play an important role for host adaptation 10 . Lastly, M-segment splicing does not only depend on cis-regulatory elements but also on trans-acting factors, such as NS1, RdRp, NS1-BP or HNRNPK 56,[64][65][66] . Indeed, while M1 production was clearly impaired in our mutant strain ( Figure 6B), the wild-type bird-adapted strain produced even less ( Figure 3A).…”