Co-Expression of Host and Viral MicroRNAs in Porcine Dendritic Cells Infected by the Pseudorabies Virus

Abstract

MicroRNAs are small non-coding RNAs approximately 22 nt long that modulate gene expression in animals and plants. It has been recently demonstrated that herpesviruses encode miRNAs to control the post-transcriptional regulation of expression from their own genomes and possibly that of their host, thus adding an additional layer of complexity to the physiological cross-talk between host and pathogen. The present study focussed on the interactions between porcine dendritic cells (DCs) and the Pseudorabies virus (PRV), an alpha-herpesvirus causing Aujeszky's disease in pigs. A catalogue of porcine and viral miRNAs, expressed eight hours post-infection, was established by deep sequencing. An average of 2 million reads per sample with a size of 21–24 nucleotides was obtained from six libraries representing three biological replicates of infected and mock-infected DCs. Almost 95% of reads mapped to the draft pig genome sequence and pig miRNAs previously annotated in dedicated databases were detected by sequence alignment. In silico prediction allowed the identification of unknown porcine as well as of five miRNAs transcribed by the Large Latency Transcript (LLT) of PRV. The gene target prediction of the viral miRNAs and the Ingenuity Pathway Analysis of differentially expressed pig miRNAs were conducted to contextualize the identified small RNA molecules and functionally characterize their involvement in the post-transcriptional regulation of gene expression. The results support a role for PRV miRNAs in the maintenance of the host cell latency state through the down-regulation of immediate-early viral genes which is similar to other herpesviruses. The differentially expressed swine miRNAs identified a unique network of target genes with highly significant functions in the development and function of the nervous system and in infectious mechanisms, suggesting that the modulation of both host and viral miRNAs is necessary for the establishment of PRV latency.

A 2.5-Kilobase Deletion Containing a Cluster of Nine MicroRNAs in the Latency-Associated-Transcript Locus of the Pseudorabies Virus Affects the Host Response of Porcine Trigeminal Ganglia during Established Latency

“…In the ganglia latent for parental PrV (WT ganglia), we detected all of the mature PrV miRNAs described so far, which are encoded by 11 miRNA genes clustering in the LLT intron (22,23). No new PrV miRNAs were identified (Table 2).…”

“…Finally, given the limited knowledge of the PrV LAT locus, we cannot totally exclude that the 2.5-kb deletion removed regulatory sequences which may affect LLT expression in neurons (54). In addition to LLT, all of the PrV miRNAs previously described from productively infected cells (22,23) were detected in latent ganglia. The two most abundant miRNAs in WT ganglia, prvmiR-LLT1-3p and prv-miR-LLT2-5p, which are absent from the mutant PrV genome, are highly expressed during productive infection in PK15 cells (Table 2 and Fig.…”

“…6). Prv-miR-LLT1 is also the most highly expressed PrV miRNA in dendritic cells (22) and is the only one detected in trigeminal ganglia of pigs during acute infection, albeit at reduced sequencing depth (48). It is interesting that prv-miR-LLT10-3p, which maps outside the deleted region, was expressed by both M and WT virus at levels similar to those of prv-miR-LLT1-3p and prv-miR-LLT2-5p, which contrasts with the low expression of this miRNA during productive infection ( Table 2 and Fig.…”

“…The provided selection cassette conferring streptomycin sensitivity (RpsL) and kanamycin resistance (KanR) was amplified by PCR (Pfx DNA polymerase; Life Technologies) with primers PDMIRN-F (5=-CGG TGGGTCGACGGCTCCTGGGGCTGAAAGCGGCGCTGCGGATCC CCCGCggcctggtgatgatggcgggatcg-3=) and PDMIRN-R (5=-GTGTGCGT GTGCGAGAGAGAA GAGATGCGGGGGAGGGCGGCGGGCGCTTGt cagaagaactcgtcaagaaggcg-3=), which contained 5= extensions (uppercase letters) corresponding to nucleotides 98050 to 98099 and the reversal of nucleotides 100571 to 100620 of the PrV-Ka genome sequence, respectively (GenBank accession number JQ809328) (26). The 1,419-bp PCR product was used for Red/ET-mediated recombination with pPrV-⌬gGG, (22,23) are shown as arrowheads numbered from 1 to 11 (corresponding to miRNA genes from prv-mir-LLT1 to prv-mir-LLT11). In pPrV-⌬miRN, the majority of the miRNA genes were deleted and replaced by selection markers (RpsL and KanR) used for BAC mutagenesis in E. coli.…”

“…In PrV, a cluster of 11 miRNA genes has been identified by deep sequencing in porcine immature dendritic cells (22) and in a porcine kidney (PK15) cell line (23) during lytic infection. This cluster is entirely contained within the ϳ4.6-kb intron of the LLT, which functions as a primary miRNA precursor (23).…”