Cloning of a Novel Receptor Subunit, AcPL, Required for Interleukin-18 Signaling

Abstract

We have identified a novel member of the interleukin-1 (IL-1) receptor family, which we have termed AcPL. In transient transfection assays, we were unable to demonstrate a role for AcPL in IL-1-induced activation of NFB. Interleukin-18 (interferon-␥-inducing factor) is another member of the IL-1 family of cytokines, and it has recently been shown that IL-18 has a weak affinity for IL-1R-rp1. We examined whether AcPL might function alone or in concert with IL-1R-rp1 to mediate IL-18 signaling. We found that both IL-1R-rp1 and AcPL expression were required for induction of NFB activity and for activation of c-Jun N-terminal kinase in response to IL-18. Furthermore, a dominant negative version of AcPL specifically inhibited IL-18 signaling. In vitro immunoprecipitation assays demonstrated that AcPL alone was unable to bind IL-18 with any appreciable affinity. We propose that although IL-1R-rp1 binds the cytokine, IL-1R-rp1 and AcPL proteins are both required for IL-18 signaling, analogous to the requirement for both IL-1R and IL-1RAcP in IL-1-mediated responses.

Evidence for an Accessory Protein Function for Toll-Like Receptor 1 in Anti-Bacterial Responses

“…Molecular studies of IL-1R family members, the signaling domain of which are closely related to those of TLRs, suggests that agonist-driven heterodimerization is a the mechanism for signal activation in TIR domain-containing proteins (40). In the case of the receptors for IL-1 and IL-18, both chains of a heterodimer are known to be required for cytokine signaling (22,23). A similar mechanism in the TLR family seems plausible given the results obtained in this study and the close sequence homology (41) between TIR domains of IL-1R family members and TLRs.…”

“…IL-1 and IL-18 signaling is mediated not by a single IL-1R family member, but by a heterodimer consisting of two family members. Only one chain is a high affinity cytokine binding protein (20,21), although the accessory member of the heterodimer is essential for cytokine signaling (22,23). Accessory proteins are structurally very similar to other family members, and their accessory role cannot be distinguished from that of other IL-1R family members by primary sequence analysis.…”

IL-21 Up-Regulates the Expression of Genes Associated with Innate Immunity and Th1 Response

“…Total cellular RNA was quantified photometrically and the samples containing equal amounts of RNA (10 g) were size fractionated on a 1.0% formaldehydeagarose gel and transferred to a nylon membrane (Hybond; Amersham, Buckinghamshire, U. K.). The membrane was hybridized with the cDNA probes for human IFN-␥ (13), T-bet, IL-2R␣, IL-12R␤2, IL-18R␣ (14), IL-18R␤ (15), and MyD88 (16). T-bet and IL-12R␤2 probes were cloned from total cellular RNA obtained from IL-15-, IL-18-, and IL-21-treated NK-92 cells by RT-PCR using oligonucleotides CCGCCTGGATC CAACTGTCAATTC (sense), ATCATGGGATCCGCTCAGTTGGGA (antisense), AGGGAAAAAGGATCCCAAGGTCAT (sense), and AGAC CAACTCCCGGATCCTAAGAC (antisense), respectively.…”

Adenoviral delivery of IL-18 binding protein C ameliorates Collagen-Induced Arthritis in mice

“…Initiation of intracellular signalling by secreted IL-18 starts with the formation of a high-affinity receptor complex, comprising out of the IL-18 binding areceptor chain (IL-18Ra) and the b-chain (IL-18Rb), which itself cannot bind IL-18. 10,11 Dimerization of both receptor units upon IL-18 binding results in activation of intracellular signal transduction pathways induced by recruitment of the adapter protein MyD88 towards the receptor complex, followed by binding of interleukin receptor activated kinase (IRAK) and TNF receptor associated factor-6 (TRAF-6). The formation of this activation complex of the IL-18 signal cascade finally leads to downstream NFkB-mediated activation of transcription.…”