The 3-phenoxybenzoate (3-PBA) 1=,2=-dioxygenase gene cluster (pbaA1A2B cluster), which is responsible for catalyzing 3-phenoxybenzoate to 3-hydroxybenzoate and catechol, is inducibly expressed in Sphingobium wenxiniae strain JZ-1 T by its substrate 3-PBA. In this study, we identified a transcriptional activator of the pbaA1A2B cluster, PbaR, using a DNA affinity approach. PbaR is a 253-amino-acid protein with a molecular mass of 28,000 Da. PbaR belongs to the IclR family of transcriptional regulators and shows 99% identity to a putative transcriptional regulator that is located on the carbazole-degrading plasmid pCAR3 in Sphingomonas sp. strain KA1. Gene disruption and complementation showed that PbaR was essential for transcription of the pbaA1A2B cluster in response to 3-PBA in strain JZ-1 T . However, PbaR does not regulate the reductase component gene pbaC. An electrophoretic mobility shift assay and DNase I footprinting showed that PbaR binds specifically to the 29-bp motif AATAG AAAGTCTGCCGTACGGCTATTTTT in the pbaA1A2B promoter area and that the palindromic sequence (GCCGTACGGC) within the motif is essential for PbaR binding. The binding site was located between the ؊10 box and the ribosome-binding site (downstream of the transcriptional start site), which is distinct from the location of the binding site in previously reported IclR family transcriptional regulators. This study reveals the regulatory mechanism for 3-PBA degradation in strain JZ-1 T , and the identification of PbaR increases the variety of regulatory models in the IclR family of transcriptional regulators.T he main metabolite in the degradation of insecticide pyrethroids in mammals (1), insects (2), fungi (3), and bacteria (4, 5) is 3-phenoxybenzoate (3-PBA), a diaryl ether compound. Because of the wide use of pyrethroids (6) and the stability of the diaryl ether compound itself (7), 3-PBA is typically detected as an important environmental contaminant. To date, two biodegradation systems of 3-PBA have been identified in bacteria (see Fig. S1 in the supplemental material): (i) the PobAB system in Pseudomonas pseudoalcaligenes POB310 (8), which is a type I Rieske nonheme iron aromatic-ring-hydroxylating oxygenase (RHO), and (ii) the type IV RHO PbaA1A2BC system in Sphingobium wenxiniae JZ-1 T (9). Due to hydroxylation at different positions in the aromatic ring (9), 3-PBA is catabolized to protocatechuate and phenol in the first system and to 3-hydroxybenzoate and catechol in the second system. Although the molecular mechanism of 3-PBA degradation in bacteria has been well characterized (8, 9), the regulation of its degradation is still unknown.Strain JZ-1 T can utilize pyrethroids, such as cypermethrin, cyhalothrin, deltamethrin, fenpropathrin, fenvalerate, permethrin, and bifenthrin, and their metabolite 3-PBA as the sole carbon and energy sources for growth (5, 9). The esterase gene pytH, which is responsible for the first step of hydrolyzing pyrethroids, is constitutively expressed (5), while the expression of the 3-PBA catabolic gene cl...