Cloning, expression, and characterization of a novel CTP synthase gene from Anoxybacillus gonensis G2

Abstract

The cytidine-5'-triphosphate (CTP) synthase (EC 6.4.3.2) gene (pyrG) was cloned and sequenced from the thermophilic bacterium Anoxybacillus gonensis G2 (Ago). The gene is 1590 bp in length and encodes a protein of 530 amino acids, with a molecular mass of 59.5 kDa. The amino acid sequence of CTP synthase shares approximately 90%-94% similarity to Bacillus sp., and it belongs to the triad glutamine amidotransferases, which utilize a Cys-His-Glu triad for activity. Multiple sequence alignments revealed that the enzyme includes conserved amino acids responsible for catalytic activity and the binding of a divalent metal ion (Mg +2 ). AgoCTP synthase (AgoG2CTPs) was overproduced in Escherichia coli BL21 (DE3) pLysS as recombinant and purified by nickel affinity chromatography. Its biochemical characterization showed that the enzyme had maximal activity at pH 9.0-10.0 and 65 °C. K m , V max , and k cat were found to be approximately 12.415 mM, 0.381 U/L, and 0.762 s -1 at 65 °C, respectively. CTP synthase promotes the formation of CTP in dividing cells and is a recognized target for anticancer and antibacterial drugs. The results obtained from this study can be improved upon with the use of different species and substrates.

Cloning, Purification and Characterization of Acetyl Xylane Esterase from Anoxybacillus flavithermus DSM 2641T with Activity on Low Molecular-Weight Acetates

“…In the present work, we describe a pdaB-like AXE from spore forming thermophilic bacteria A. flavithermus DSM 2641 T that exhibit significant deacetylase activity towards chromogenic artificial acetate substrates a-NAc and p-NPAc. To date, 19 species and numerous carbohydrate metabolism related enzymes have been reported from Anoxybacillus genus [11]. Our study is the first enzymological description of a pdaBlike family 4 carbohydrate esterase from this genus.…”

Bacterial toxin colicin N-T domain structure changes to ordered state upon binding C-terminal domain of TolA

“…The cells were lysed by French press and the supernatant was obtained by ultracentrifugation at 40,000 rpm (45 Ti rotor used at 4 °C) for 1 h. The fusion protein was found to be soluble, with none remaining in the cell membrane pellet. The N-terminal 6X histidine tag facilitated purification of the fusion by means of a QIAGEN Ni-NTA affinity column (Hochuli et al, 1987;Chen et al, 2014;Sandallı et al, 2014). The fusion protein was washed onto the column with a 50 mM phosphate and 300 mM NaCl (pH 8.0) buffer, additionally washed with the same buffer containing 30 mM imidazole, and eluted in 300 mM imidazole (pH 7.0).…”

“…First, DNA encoding the TolA-III domain was amplified using 2 oligonucleotides (TOLAXHOSENSE: TTTTTCTCGAGCAACAATGGCGCATCAGGG and TOLABMLUREV: TTTTTGGATCCCCCACCCGG TTTGAAGTCCAATGGCGC) with an 18 bp matching sequence to TolA-III and plasmid pSK17 from Citrobacter freundii as a template. The pET8c vector was designed to introduce a 6-histidine and 2-serine linker at the N-terminus of this construct, which facilitates purification via nickel affinity chromatography (Politou et al, 1994;Sandallı et al, 2014). The DNA fragment encoding TolA-III and an extra BamHI restriction site was included to introduce the T-domain of colicin N into the pET8C vector using XhoI and MluI restriction sites.…”