Cloning and structure analysis of hydrogenase gene from Chlamydomonas reinhardtii SE

Zhang, Linghua; Zhang, Wei; Jin, Meifang; Zhang, Hongyan; Wang, Yunji

doi:10.1016/j.procbio.2005.01.017

Cited by 8 publications

(4 citation statements)

References 13 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…29 A few primers for the hydrogenase expression (e.g. HdyA2) 22 of C. reinhardtii were tried and 16S rRNA was selected as the reference gene. Real-time PCR is rapid and sensitive and it has a large dynamic range.…”

Section: Resultsmentioning

confidence: 99%

See 1 more Smart Citation

Recognition of algae by microcontact-imprinted polymers modulates hydrogenase expression

et al. 2014

View full text Add to dashboard Cite

show abstract

Section: Resultsmentioning

confidence: 99%

“…The sequence (5 0 -3 0 ) of primers for HydA2 (ref. 22) and 16S rRNA genes: HydA2, forward: CCCGACTCAGCCTACTTGTT; reverse: CGCCTCCCACTACCACCATA. 16S rRNA, forward: CAGCTCGT GTCGTGAGATGT; reverse: TAGCACGTGTGT AGCCCAAC.…”

Section: Gene Expression Of Algae On Algae-imprinted Eval Thin Lmsmentioning

confidence: 99%

Recognition of algae by microcontact-imprinted polymers modulates hydrogenase expression

et al. 2014

View full text Add to dashboard Cite

show abstract

“…Algae, e.g., Platymonas subcordiformis [113][114][115], Chlamydomonas reinhardtii [116,117], Spirulina platensis [101] and photosynthetic bacteria, e.g. : Rhodobacter sphaeroides [118][119][120], Rhodobacter capsulatus [121], Rhodopseudomonas acidophila [122], Rhodopseudomonas capsulate [123], and Rhodopseudomonas palustris [124], have been isolated and studied in China.…”

Section: Photobiological Hydrogen Productionmentioning

confidence: 99%

“…The group also cloned and analysed the structure of hydrogenase gene from C. reinhardtii SE [117]. The hydrogenase is composed of 3584 bp encoding 505 amino acids in length with a predicted M.W.…”

Section: Photobiological Hydrogen Productionmentioning

confidence: 99%