Cloning and sequencing of the metallothioprotein beta-lactamase II gene of Bacillus cereus 569/H in Escherichia coli

Abstract

The structural gene for l-lactamase II (EC 3.5.2.6), a metallothioenzyme, from Bacillus cereus 569/H (constitutive for high production of the enzyme) was cloned in Escherichia coli, and the nucleotide sequence was determined. This is the first class B ,l-lactamase whose primary structure has been reported. The amino acid sequence of the exoenzyme form, deduced from the DNA, indicates that P-lactamase II, like other secreted proteins, is synthesized as a precursor with a 30-amino acid N-terminal signal peptide. The pre-I8-lactamase II (Mr, 28,060) is processed in E. coli and in B. cereus to a single mature protein (Mr, 24,932) which is totally secreted by B. cereus but in E. coli remains intracellular, probably in the periplasm. The expression of the gene in E. coli RR1 on the multicopy plasmid pRWHO12 was comparable to that in B. cereus, where it is presumably present as a single copy. The three histidine residues that are involved (along with the sole cysteifte of the mature protein) in Zn(II) binding and hence in enzymatic activity against ,-lactams were identified. These findings will help to define the secondary structure, mechanism of action, and evolutionary lineage of B. cereus I8-lactamase II and other class B I8-lactamases. P-Lactamnases are widely distributed in bacteria (10). They differ in their enzymic and molecular properties and are thought to have a polyphyletic origin (2, 3). Some are chromosomally encoded (e.g., the ,-lactamase of Bacillus licheniformis), while others are plasmid borne (e.g., some P-lactamases of Staphylococcus aureus). P-Lactamases are grouped into three classes based on size and sequence homology (3, 19). Some of the secreted 3-lactamnases of Bacillus spp. and Staphylococcus spp. and the periplasmic R6K ,-lactamase carried on pBR322 in Escherichia coli (42) fall in class A. They are highly active on benzylpenicillin, have an Mr of-30,000, and show considerable homology with one another. They have a serine at the active site and are thought to have diverged from a single ancestral gene (3). Class B P-lactamases are Of Mr-23,000, are almost as active towards cephalosporins as penicillins, and are metallothioenzymes. This class is restricted to B. cereus and very closely related bacilli (21) and possibly Pseudomonas maltophilia P-lactamase Li (37). Primary structure has not been reported for any of the class B ,-lactamases. Class C was added by Jaurin and Grundstrom (19) to accommodate the ampC gene product, a chromosomally encoded cephalosporinase of E. coli. It is a mnolecule of Mr-39,000, with * Corresponding author. two Zn(II) ions per enzyme molecule (5, 13). Hydrolysis of

The 3-D structure of a zinc metallo-beta-lactamase from Bacillus cereus reveals a new type of protein fold.

“…Clearly, a hydrogen-bond network involving Zn2+, Watl, Asp9O and Cys168 is important for enzymatic activity. (Ambler et al, 1985;Hussain et al, 1985;Kato et al, 1985); Xm, X.maltophilia (Walsh et al, 1994); Bf, B.fragilis (Rasmussen et al, 1990;Thompson and Malamy, 1990); Sm, Smarcescens (Osano et al, 1994); Ah, A.hydrophila (Massida etal., 1991).…”

“…The site-directed mutagenesis was performed by inverse PCR (Clackson et al, 1991) using the following strategy. A SstII-PstI (-650 bp) fragment comprising the triplet to be mutated was isolated from plasmid pRWHO12 (Hussain et al, 1985) and subcloned into plasmid pSL1 180 (Pharmacia, LKB Biotechnology). The pair of primers was designed in inverted tail-to-tail directions: a 23 base primer (AATTCGATCAGCGTGCGCATGTG) annealing perfectly with the target sequence and a 28 base primer (GGCGGAATAAAATGTTTGAAAGAAAGAG) introducing three contiguous mismatches for replacing the ACG triplet in the coding sequence.…”

Crystal structure of NDM‐1 reveals a common β‐lactam hydrolysis mechanism

“…Based on the metal binding diversity, MBLs have been divided further into 3 subclasses: B1, B2, and B3. Those belonging to subclass B1, including BcII from Bacillus cereus (8), CcrA from Bacteroides fragilis (9), IMP‐1 from Serratia marcescens (10) and VIM‐2 from Pseudomonas aeruginosa (11), can bind up to 2 zinc ions at their active sites. They are active in both monozinc and dizinc forms, although the binding of the second zinc ion improves the activity, such as BcII (12).…”

Rapid Functional Definition of Extended Spectrumβ‐Lactamase Activity in Bacterial CulturesviaCompetitive Inhibition of Fluorescent Substrate Cleavage

“…For this purpose we chose B. cereus penicillinase (Sigma Aldrich) ( Table 1). B. cereus penicillinase is a Class A serine enzyme, has a broad spectrum of hydrolytic activity and is known to preferentially hydrolyze penicillins as compared with cephalosporins making it an ideal choice for testing the inhibitory effects of a panel of b-lactam antibiotics comprising penicillins and cephalosporins (7). Competitive inhibition reactions were monitored for 30 min and the data were then fit to determine the C i for each antibiotic tested.…”