Cloning and sequencing of the cDNA encoding a mouse tissue inhibitor of metalloproteinase-2

Shimizu, Satoru; Malik, Karim; Sejima, Hiroe; Kishi, Jun-Ichi; Hayakawa, Taro; Koiwai, Osamu

doi:10.1016/0378-1119(92)90591-c

Cited by 35 publications

(15 citation statements)

References 5 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…It is intriguing to notice that the apparent molecular mass of TIMP-2 from mouse A-NK cells is 29 kDa, which is different from those of human HT-1080 cells, or mouse B16F1 melanoma cells (see below). It has been shown that TIMP-2 cDNAs cloned from cultured colon 26 mouse carcinoma cells and from human heart tissue have 92% homology at the cDNA level and 97% homology at the protein level; these are also known to be nonglycosylated proteins (52). Moreover, TIMP-2 proteins purified from human and mouse serum showed similar molecular mass at 24 kDa in Western blot by the TIMP-2 mAb (11).…”

Section: Discussionmentioning

confidence: 99%

Secreted and Membrane-Associated Matrix Metalloproteinases of IL-2-Activated NK Cells and Their Inhibitors

Kim

Kitson

Albertsson

et al. 2000

The Journal of Immunology

View full text Add to dashboard Cite

We have previously documented that rat IL-2-activated NK (A-NK) cells produce matrix metalloproteinase-2 (MMP-2) and MMP-9. In this study, we describe mouse A-NK cell-derived MMPs, including MT-MMPs, and also TIMPs. RT-PCR analysis from cDNA of mouse A-NK cells revealed mRNA for MMP-2, MMP-9, MMP-11, MMP-13, MT1-MMP, MT2-MMP, TIMP-1, and TIMP-2. MMP-2 and MMP-9 expression was confirmed by gelatin zymography. Moreover, we report for the first time that MT-MMPs are expressed by NK cells, i.e., large granular lymphocytes as determined by both RT-PCR and Western blots. TIMP-1 expression was detected as a 29-kDa protein in Western blots. It is intriguing that TIMP-2 protein from A-NK cells was also detected as a 29-kDa protein, which is clearly different from the previously reported molecular mass of 21 kDa in mouse and human cells. In addition, inhibition of MMPs by BB-94, a selective inhibitor of MMP, significantly inhibited the ability of mouse A-NK cells to migrate through Matrigel, a model basement membrane. Taken together, these findings suggest that A-NK cells may therefore use multiple MMPs in various cellular functions, including degradation of various extracellular matrix molecules as they extravasate from blood vessels and accumulate within cancer metastases following their adoptive transfer.

show abstract

Section: Discussionmentioning

confidence: 99%

Secreted and Membrane-Associated Matrix Metalloproteinases of IL-2-Activated NK Cells and Their Inhibitors

Kim

Kitson

Albertsson

et al. 2000

The Journal of Immunology

View full text Add to dashboard Cite

show abstract

“…Amplification of cDNA by PCR was performed under the following conditions: 94 o C for 30 sec, annealing temperature shown in Table 1 for 30 sec, and 72 o C for 1 min followed by a final heating at 72 o C for 10 min. The primer sequences used for PCR amplification were designed based on cDNA sequences as indicated in Table 1 (11,32,(36)(37)(38)(39)(40)(41)(42)(43)(44)(45)(46). Amplified PCR products were subcloned into the pGEM ® -T vector (Promega, Madison, WI) using the pGEM ® -T Vector System II and the sequences of the subcloned cDNAs were checked by a DNA sequencer (Prism 310, Applied Biosystems, Foster city, CA).…”

Section: Reverse Transcriptase-polymerase Chain Reaction (Rt-pcr)mentioning

confidence: 99%

Regulation of matrix metalloproteinase-13 and tissue inhibitor of matrix metalloproteinase-1 gene expression by WNT3A and bone morphogenetic protein-2 in osteoblastic differentiation

Nakashima

Tamura²

2006

Front Biosci

View full text Add to dashboard Cite

“…To obtain the two terminal Timp-2 exons, primer pairs were designed to the 5Ј (sense, CTGCGC-CCCTTGACAAAGA; antisense, TGCATTGCAAAACGCCTGTT) and 3Ј (sense, CTTGACATCGAGGACCCGTAAGAAG; antisense, CAT-GGGGCTGACTGGGACTC) untranslated regions of the mouse Timp-2 cDNA (12). PCR of those probes was used to screen pools of 129/OLA mouse genomic DNA P1 phage clones (Genome Systems, St. Louis, MO) to obtain the entire Timp-2 locus.…”

Section: Isolation and Characterization Of The Mouse Genomic Timp-2 Lmentioning

confidence: 99%

Inactivating Mutation of the Mouse Tissue Inhibitor of Metalloproteinases-2(Timp-2) Gene Alters ProMMP-2 Activation

Caterina¹,

Yamada²,

Caterina³

et al. 2000

Journal of Biological Chemistry

134

109

View full text Add to dashboard Cite

To understand the biologic function of TIMP-2, a member of the tissue inhibitors of metalloproteinases family, an inactivating mutation was introduced in the mouse Timp-2 gene by homologous recombination. Outbred homozygous mutants developed and procreated indistinguishably from wild type littermates, suggesting that fertility, development, and growth are not critically dependent on TIMP-2. Lack of functional TIMP-2, however, dramatically altered the activation of proMMP-2 both in vivo and in vitro. Fully functional TIMP-2 is essential for efficient activation of proMMP-2 in vivo. No evidence of successful functional compensation was observed. The results illustrate the duality of TIMP-2 function, i.e. at low concentrations, TIMP-2 exerts a "catalytic" or enhancing effect on cell-mediated proMMP-2 activation, whereas at higher concentrations, TIMP-2 inhibits the activation and/or activity of MMP-2.

show abstract

Cloning and sequencing of the cDNA encoding a mouse tissue inhibitor of metalloproteinase-2

Cited by 35 publications

References 5 publications

Secreted and Membrane-Associated Matrix Metalloproteinases of IL-2-Activated NK Cells and Their Inhibitors

Secreted and Membrane-Associated Matrix Metalloproteinases of IL-2-Activated NK Cells and Their Inhibitors

Regulation of matrix metalloproteinase-13 and tissue inhibitor of matrix metalloproteinase-1 gene expression by WNT3A and bone morphogenetic protein-2 in osteoblastic differentiation

Inactivating Mutation of the Mouse Tissue Inhibitor of Metalloproteinases-2(Timp-2) Gene Alters ProMMP-2 Activation

Contact Info

Product

Resources

About