Cloning and expression in Escherichia coli of an extremely thermostable oligo-1,6-glucosidase gene from Bacillus thermoglucosidasius

Abstract

The gene for an extremely thermostable oligo-1,6-glucosidase (dextrin-6-a-D-glucanohydrolase; EC 3.2.1.10) of obligately thermophilic Bacillus thermoglucosidasius KP1006 was cloned within a 4.2-kilobase HindIII-PvuII fragment of DNA by using the plasmid pUC19 as a vector and Escherichia coli C600 as a host. The gene was transcribed, presumably from its own promoter, in E. coli. E. coli with the hybrid plasmid accumulated oligo-1,6-glucosidase mainly in the cytoplasm. The level of enzyme production was comparable to that observed for B. thermoglucosidasius. The enzyme coincided absolutely with the B. thermoglucosidasius enzyme in its molecular weight (60,000), in its electrophoretic behavior on denaturing and nondenaturing polyacrylamide gels, in the temperature dependency of its stability and activity, and in its antigenic determinants.Five p-nitrophenyl-a-D-glucopyranoside-hydrolyzing oligo-1,6-glucosidases (dextrin 6-a-D-glucanohydrolase; EC 3.2.1.10) from various Bacillus species with different ranges of growth temperature were compared for their thermostability, amino acid composition, and structural parameters calculated from amino acid composition (19). From this analysis, in conjunction with the strong site specificity of proline residues for the n-turn (2,3,8), it has been proposed that enhanced thermostability of Bacillus oligo-1,6-glucosidases would be gained by increasing the frequency of proline occurrence at n-turns and the total hydrophobic residues (19). This appeared to be given strong support by Matthews et al. (10); very recently, these authors increased the thermostability of bacteriophage T4 lysozyme by replacing alanine with proline at one of the n-turns to decrease the backbone entropy of unfolding. Site-directed mutagenesis of individual Bacillus oligo-1,6-glucosidases, followed by analysis of their altered thermostability, would provide the concrete information needed to confirm the above hypothesis. In the present study, as a first step toward fulfilling this purpose, a Bacillus thermoglucosidasius KP1006 (DSM2542; an obligate thermophile) gene coding for an extremely thermostable oligo-1,6-glucosidase was cloned and expressed in Escherichia coli.E. coli C600 (F-thi-i thr-J leuB6 lacYl tonA21 supE44 A-) and E. coli JM109 [recAl endAl gyrA96 thi hsdRI7 supE44 relAl X-A(lac-proAB) F'(traD36 proA+B+ lacIq lacZAM15)] were used (1). Aerobic cultivation was carried out at 370C in L broth (pH 7.2), consisting of 1% peptone, 0.5% yeast extract, 0.5% NaCl, 0.1% glucose, and distilled water. All DNA manipulations were as described by Maniatis et al. (9). Restriction endonucleases and T4 DNA ligase were used as specified by the supplier (Toyobo, Osaka, Japan, or Takara Shuzo, Kyoto, Japan). Cellular and extracellular oligo-1,6-glucosidase activities were assayed with p-nitrophenyl-a-D-glucopyranoside as the substrate (16,22 phenyl-cX-D-glucopyranosidase active at 60'C nor a protein cross-reactive with rabbit antiserum against B. thermoglucosidasius KP1006 oligo-1,6-glucosidase on double immunodiffu...

Primary structure of the oligo‐1,6‐glucosidase of Bacillus cereus ATCC7064 deduced from the nucleotide sequence of the cloned gene

“…Expression of the B. cereus oligo-1,6-glucosiduse gene in E. coli C6UU bearingpBCE4. E. coli C600 bearing pBCE4 was grown at 31 "C overnight under shaking test tubes each containing 5 ml of L-broth with ampicillin (50 pg/ml) added [7]. The culture (1 ml) was transferred to a 2-1 Erlenmeyer flask containing 200ml L-broth with ampicillin (50 pg/ml), followed by cultivation at 37°C for 24 h with shaking.…”

“…The supernatant was assayed for oligo-I ,6-glucosidase activity [extracellular fraction ( O ) ] . The cell pellet was sonicated for 2 min at 4°C in 2 ml buffer A [7] and assayed for remaining activity [cellular activity ( O ) ] . The activity was expressed as the value found in 1 ml culture.…”

“…Cumulative site-directed mutagenesis of the multiple sites on individual Bacillus oligo-l,6-glucosidases, followed by analysis of their altered thermostability, could provide the concrete information needed to confirm the above hypothesis. As a first step toward fulfilling this purpose, cloning of these enzyme genes is under way in our laboratories [7]. In the present study, we have cloned the oligo-I ,6-glucosidase gene from Bacillus cereus ATCC7064 (mesophile) in Escherichia coli and deduced the amino acid sequence of the enzyme from the nucleotide sequence of the cloned gene.…”

Renaturation of Bacillus thermoglucosidasius HrcA Repressor by DNA and Thermostability of the HrcA-DNA Complex In Vitro

“…Extraction of genomic DNA from B. thermoglucosidasius KP1006 was carried out as described before (24). Two primers, HF (CGGAAT TCGAAGAAATGTTTTTTGGG) and HR (AGGCTGCAGTTTTCCATT), were used to amplify the DNA fragment containing the B. thermoglucosidasius hrcA gene and its flanking region by PCR with B. thermoglucosidasius genomic DNA as the template.…”

Two Thimet Oligopeptidase-Like Pz Peptidases Produced by a Collagen- Degrading Thermophile, Geobacillus collagenovorans MO-1

“…Gene cloning and analysis. The chromosomal DNA of G. collagenovorans MO-1 was isolated from the cells cultivated in L broth for 8 h and digested with HindIII, SphI, or EcoRI to construct libraries with the vector pUC119 and the host Escherichia coli DH5␣, following the method described previously (42). Two pairs of PCR primers were designed from the N-terminal and internal amino acid sequences of Pz peptidases A (primer AF, CGCGGATCCATGAAATTYWSB GAATTTCGCTATGAA; primer AR, RTTGGATCCRTTTTCRTANACRAA RTGTTGRAATTC [B ϭ C, G, or T; R ϭ A or G; S ϭ C or G; W ϭ A or T; Y ϭ C or T]) and B (primer BF, CGCGGATCCATGGAAGCAAAACAAAC NAAAAAA; primer BR, YSWGGATCCTTGCATNACTTCNGCNGCTTGN GCNAG) to amplify the DNA probe for colony hybridization.…”