Cloning and Characterization of the Replication Origin from Rat Mitochondrial DNA

Decreased mitochondrial gene expression in isolated islets of rats injected neonatally with streptozotocin

“…Track 1 shows the nucleotide sequence of a fragment of the Dloop containing region from three STZ-rats and five control rats and corresponds to the H-strand (5'-3'). Track 2 shows the nucleotide sequence of the same region reported by Koike et al [27]. Underlined letters represent dissimilarities between the reported and the presently observed nucleotide sequences insulin gene and the stability of insulin mRNA [34].…”

“…The following two oligonucleotide primers were employed in the reactions: 5'CCCGAATTCTI'GTCTATGAGGA-TAAAT and GGGGGATCCGTAACGGGTCATCGC CCA. The sequences of the oligonucleotides are taken from Koike et al [27] and represent a DNA segment surrounding the replication origin of rat mtDNA. The amplification products were analysed on agarose gels and DNA fragments of the expected size were excised and electro eluted.…”

“…Since approximately 200 base pairs were sequenced from each STZ-rat, a total of 600 base pairs of STZ-treated mitochondrial D N A was free from any mutations. In track 2, Figure 4, the nucleotide sequence of the same region reported by Koike et al [27] is given for comparison. The observed differences in the sequences may be explained by intraspecies polymorphism.…”