Cloning and Analysis of Authentic Patient-Derived HCV E1/E2 Glycoproteins

Urbanowicz, Richard A.; Ball, Jonathan K.; Tarr, Alexander W.

doi:10.1007/978-1-4939-8976-8_19

Cited by 3 publications

(1 citation statement)

References 16 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The viral RNA extracted for HCV genotyping was used to amplify the E1E2 from eight 1a patient-derived viruses. A nested RT-PCR was carried out using the Qiagen OneStep RT-PCR Kit (Qiagen, Hilden, Germany) following manufacturer’s instructions with the following pairs of primers (numbering reference to GenBank accession AF011751) 61 : 5′GGACGGGGTAAACTATGCAACAGG3′ (nucleotide position 818–841), 5′GGGATGCTGCATTGAGTA3′ (nucleotide position 2599–2616), 5′CACCATGGGTTGCTCTTTTTCTATC3′ (nucleotide position 843–869) and 5′TTACGCCTCCGCTTGGGATATGAGTAACATCAT3′ (nucleotide position 2550–2582). The PCR products were sequenced by the Sanger method with the previous inner forward and reverse primers and two additional primers: 5′AGSGTAYTWYTCCATGG3′ (nucleotide position 1418–1434) and 5′CARCCRAACCARTTGCCC3′ (nucleotide position 1996–1979).…”

Section: Methodsmentioning

confidence: 99%

Rapid decrease in titer and breadth of neutralizing anti-HCV antibodies in HIV/HCV-coinfected patients who achieved SVR

Vigón

Vázquez-Morón

Berenguer

et al. 2019

Sci Rep

View full text Add to dashboard Cite

The main targets for neutralizing anti-hepatitis C virus (HCV) antibodies (HCV-nAbs) are the E1 and E2 envelope glycoproteins. We have studied the characteristics of HCV-nAbs through a retrospective study involving 29 HIV/HCV-coinfected patients who achieved sustained virological response (SVR) with peg-IFNα + ribavirin anti-HCV therapy. Plasma samples at baseline and week 24 after SVR were used to perform neutralization assays against five JFH1-based HCV recombinant viruses coding for E1 and E2 from genotypes 1a (H77), 1b (J4), 2a (JFH1), 3a (S52) and 4a (ED43). At baseline, the majority of plasma samples neutralized 1a, 1b, 2a, and 4a, but not 3a, genotypes. Twenty-four weeks following SVR, most neutralizing titers declined substantially. Furthermore, titers against 3a and 2a were not detected in many patients. Plasma samples with high HCV-nAb titers neutralized all genotypes, and the highest titers at the starting point correlated with the highest titers at week 24 after SVR. In conclusion, high titers of broad-spectrum HCV-nAbs were detected in HIV/HCV-coinfected individuals, however, those titers declined soon after SVR.

show abstract

Section: Methodsmentioning

confidence: 99%

Rapid decrease in titer and breadth of neutralizing anti-HCV antibodies in HIV/HCV-coinfected patients who achieved SVR

Vigón

Vázquez-Morón

Berenguer

et al. 2019

Sci Rep

View full text Add to dashboard Cite

show abstract

Recent advancement in small molecules as HCV inhibitors

Zhai

Wei

2022

Bioorganic & Medicinal Chemistry

View full text Add to dashboard Cite

Antibody Responses in Hepatitis C Infection

Law

2020

Cold Spring Harb Perspect Med

View full text Add to dashboard Cite

Antibody responses in hepatitis C virus (HCV) have been a rather mysterious research topic for many investigators working in the field. Chronic HCV infection is often associated with dysregulation of immune functions particularly in B cells, leading to abnormal lymphoproliferation or the production of autoantibodies that exacerbate inflammation and extrahepatic diseases. When considering the antiviral function of antibody, it was difficult to endorse its role in HCV protection, whereas T-cell response has been shown unequivocally critical for natural recovery. Recent breakthroughs in the study of HCV and antigen-specific antibody responses provide important insights into viral vulnerability to antibodies and the immunogenetic and structural properties of the neutralizing antibodies. The new knowledge reinvigorates HCV vaccine research by illuminating a new path for the rational design of vaccine antigens to elicit broadly neutralizing antibodies for protection.

show abstract

Cloning and Analysis of Authentic Patient-Derived HCV E1/E2 Glycoproteins

Cited by 3 publications

References 16 publications

Rapid decrease in titer and breadth of neutralizing anti-HCV antibodies in HIV/HCV-coinfected patients who achieved SVR

Rapid decrease in titer and breadth of neutralizing anti-HCV antibodies in HIV/HCV-coinfected patients who achieved SVR

Recent advancement in small molecules as HCV inhibitors

Antibody Responses in Hepatitis C Infection

Contact Info

Product

Resources

About