Clinical efficiency and safety of Hsp90 inhibitor Novobiocin in avian tibial dyschondroplasia

Abstract

Tibial dyschondroplasia (TD) is a bone defect of broilers and other poultry birds that disturbs growth plate and it causes lameness. Previously we evaluated differential expression of multiple genes involved in growth plate angiogenesis and reported the safety and efficacious of medicinal plant root extracted for controlling TD. In this study, clinical and protective effect of an antibiotic Novobiocin (Hsp90 inhibitor) and expression of Hsp90 and proteoglycan aggrecan was examined. The chicks were divided into three groups; Control, thiram-induced TD, and Novobiocin injected TD. After the induction of TD, the Novobiocin was administered through intraperitoneal route to TD-affected birds until the end of the experiment. The expressions and localization of Hsp90 were evaluated by qRT-PCR, immunohistochemistry (IHC) and western blot, respectively. Morphological, histological examinations, and serum biomarker levels were evaluated to assess specificity and protective effects of Novobiocin. The results showed that TD causing retarded growth, enlarged growth plate, distended chondrocytes, irregular columns of cells, decreased antioxidant capacity, reduced protein levels of proteoglycan aggrecan, and upregulated in Hsp90 expression (p < 0.05) in dyschondroplastic birds as compared with control. Novobiocin treatment restored growth plate morphology, reducing width, stimulated chondrocyte differentiation, sprouting blood vessels, corrected oxidative imbalance, decreased Hsp90 expressions and increased aggrecan level. Novobiocin treatment controlled lameness and improved growth in broiler chicken induced by thiram. In conclusion, the accumulation of the cartilage and up-regulated Hsp90 are associated with TD pathogenesis and irregular chondrocyte morphology in TD is along with reduced aggrecan levels in the growth plate. Our results indicate that Novobiocin treatment has potential to reduce TD by controlling the expression of Hsp90 in addition to improve growth and hepatic toxicity in broiler chicken.

Effect of Grape Seed Extract on Tibial Dyschondroplasia Incidence, Liver Weight, and Tibial Angiogenesis in Chickens

“…Hsp90 have important role in angiogenesis and severely affected the TD birds due to hypoxic lesion in growth plate (Iqbal et al, 2018b). Furthermore, lameness was noticed in TD chicks mainly due to the formation of avascular cartilage in proximal tibia (Nabi et al, 2016b;Nabi et al, 2018). A decline in the expression of Hsp90 was found in our trial after the use of GSE in TD chicken.…”

“…Gene specific primers were used. For HIF-1α F:TGAGAGAAATGCTTACACACAG R:TGATGGGTGAGGAATTGGTTCAC , for Hsp90 F:CCTCCTCCATACGTGATGTG TCA R:GCCTGGGCATTGATGAAGATG (Mehmood et al, 2017;Nabi et al, 2018) and for GAPDHF:CCTTCAT TGACCTTCACTACATGGTCTA R:TGGAAGATGGT GATGGCCTTTCCATTG (Mehmood et al, 2018) primers were used. Reference gene used during the PCR was GAPDH.…”

Allosteric Regulation of Hsp90α’s Activity by Small Molecules Targeting the Middle Domain of the Chaperone

“…They regulate Hsp90's function mainly via five ways: ATP competitive inhibitors, which block the access of ATP to the Hsp90's NTD (Prodromou, 2009;Roe et al, 1999;Sidera and Patsavoudi, 2014;Verma et al, 2016); inhibitors binding to the Hsp90's NTD and interfering with the interactions between Hsp90 and co-chaperones such as p23 and Cdc37 (Li et al, 2009(Li et al, , 2018Verma et al, 2016); compounds interacting with Hsp90's CTD and inhibiting its dimerization (Garg et al, 2016;Verma et al, 2016); allosteric activators binding to either the N-terminal domain or the interface region in between the middle domain and the C-terminal domain of Hsp90 (Bassanini et al, 2018;D'Annessa et al, 2017;Ferraro et al, 2019;Sattin et al, 2015;Yokoyama et al, 2015;Zierer et al, 2016;Zierer et al, 2014); and small molecules covalently bonding to the cysteine residue in the middle domain of Hsp90 (Li et al, 2016;Nakamoto et al, 2018;Zhang et al, 2018). Among the reported chemical compounds targeting Hsp90, ATP competitive inhibitors form a dominant group, and quite a few compounds from this group are undergoing clinical trials for the treatment of cancer (Nabi et al, 2018;Sidera and Patsavoudi, 2014;Tatokoro et al, 2015). Unfortunately, up to date, none of these inhibitors has been approved for cancer therapy.…”

Plastrum Testudinis Extract Mitigates Thiram Toxicity in Broilers via Regulating PI3K/AKT Signaling

“…Principal clinical aspects of TD reported by researchers are abnormal gait, reduced feed consumption, lameness in one or both legs, difficulty in standing, ataxia, and eventually death [4,10,56]. The poultry industry faces heavy economic losses due to the fact of TD, and it also affects the carcass quality and meat production [57,58]. In TD, there is an uncharacteristic protein excretion and apoptosis behavior exhibited by cartilage cells which lead to severe cell damage, ultimately triggering a reduction in the degradation rate of cartilage extracellular matrix, which confines the bone deposition space [59,60].…”