Clic4, a novel protein that sensitizes β-cells to apoptosis

Abstract

ObjectivesChloride intracellular channel protein 4 (Clic4) is a ubiquitously expressed protein involved in multiple cellular processes including cell-cycle control, cell differentiation, and apoptosis. Here, we investigated the role of Clic4 in pancreatic β-cell apoptosis.MethodsWe used βTC-tet cells and islets from β-cell specific Clic4 knockout mice (βClic4KO) and assessed cytokine-induced apoptosis, Bcl2 family protein expression and stability, and identified Clic4-interacting proteins by co-immunoprecipitation and mass spectrometry analysis.ResultsWe show that cytokines increased Clic4 expression in βTC-tet cells and in mouse islets and siRNA-mediated silencing of Clic4 expression in βTC-tet cells or its genetic inactivation in islets β-cells, reduced cytokine-induced apoptosis. This was associated with increased expression of Bcl-2 and increased expression and phosphorylation of Bad. Measurement of Bcl-2 and Bad half-lives in βTC-tet cells showed that Clic4 silencing increased the stability of these proteins. In primary islets β-cells, absence of Clic4 expression increased Bcl-2 and Bcl-xL expression as well as expression and phosphorylation of Bad. Mass-spectrometry analysis of proteins co-immunoprecipitated with Clic4 from βTC-tet cells showed no association of Clic4 with Bcl-2 family proteins. However, Clic4 co-purified with proteins from the proteasome suggesting a possible role for Clic4 in regulating protein degradation.ConclusionsCollectively, our data show that Clic4 is a cytokine-induced gene that sensitizes β-cells to apoptosis by reducing the steady state levels of Bcl-2, Bad and phosphorylated Bad.

Chloride intracellular channel 4 is required for maturation of the cerebral collateral circulation

“…Last, we used mice with a global deletion of CLIC4 because no floxed line was available. However, a mouse line with a floxed CLIC4 allele has been recently described (30), which will aid future studies.…”

Three Decades of Chloride Intracellular Channel Proteins: From Organelle to Organ Physiology

“…CLIC4, in association with CLIC5, can mediate ERM activation which is required for maintenance of the glomerular capillary architecture (Tavasoli et al, 2016). Inhibiting CLIC4 expression increases β-cell survival, possibly caused by the increased cellular expression of Bcl-2, Bcl-xL and Bad phosphorylation (Patel, Ythier, Brozzi, Eizirik, & Thorens, 2015). Bcl-2 or Bcl-xL overexpression in β-cells increases their resistance to cytokine-induced apoptosis (Patel et al, 2015).…”

“…Inhibiting CLIC4 expression increases β-cell survival, possibly caused by the increased cellular expression of Bcl-2, Bcl-xL and Bad phosphorylation (Patel, Ythier, Brozzi, Eizirik, & Thorens, 2015). Bcl-2 or Bcl-xL overexpression in β-cells increases their resistance to cytokine-induced apoptosis (Patel et al, 2015). Thus, targeting clic4 expression, its downstream signaling pathway, or its interactors may be a novel approach for preventing β-cell apoptosis in diabetes.…”

Retracted: SiRNA‐Mediated Down‐Regulation of CLIC4 Gene Inhibits Cell Proliferation and Accelerates Cell Apoptosis of Mouse Liver Cancer Hca‐F and Hca‐P Cells

“…The three interference targets of the small interfering RNA (siRNA) were CLIC4-siRNA-1; CLIC4-siRNA-2, and CLIC4-siRNA-3 with oligonucleotide sequences of 5 0 -AACCTTCAACAGCGAAGTCAA-3 0 , 5 0 -GAGAACAGCATGGAGGACATC-3 0 , and 5 0 -AACTCAAGACCA-GAGGCTAAT-3 0 , respectively. These were specifically designed according to the mRNA sequence (Genebank number: NM_013885.2) of CLIC4 of mouse cells in the Genebank, combined with the siRNA design rules [Patel et al, 2015]. According to three RNA interference target sequences, three pairs of DNA oligonucleotide templates encoded with CLIC4 siRNA were synthetized (Shanghai Sangon Biological Engineering Technology & Services Co., Ltd., Shanghai, China) as follows: Sense-CLIC4-siRNA-1: 5 0 -GATCCGCCTTCAACAGCGAAGTCAATTCAAGAGATTGACTTCGCT GTTGAAGGTTTTTTGGAAA-3 0 , Antisense-CLIC4-siRNA-1: 5 0 -AGC TTTTCCAAAAAACCTTCAACAGCGAAGTCAATCTCTTGAATTGACT TCGCTGTTGAAGGCG-3 0 , Sense-CLIC4-siRNA-2: 5 0 -GATCCGAA-CAGCATGGAGGACATCTTCAAGAGAGATGTCCTCCATGCTGTTCTT TTTTGGAAA-3 0 ; Antisense-CLIC4-siRNA-2: 5 0 -AGCTTTTCCAAAA AAGAACAGCATGGAGGACATCTCTCTTGAAGATGTCCTCCATGCT GTTCG-3 0 ; Sense-CLIC4-siRNA-3: 5 0 -GATCCGGCTCAAGACCA-GAGGCTAATTTCAAGAGAATTAGCCTCTGGTCTTGAGTTTTTTGGA AA-3 0 , Antisense-CLIC4-siRNA-3: 5 0 -AGCTTTTCCAAAAAACT-CAAGACCAGAGGCTAATTCTCTTGAAATTAGCCTCTGGTCTTGAGC CG-3 0 .…”