Citrus limon and Paradisi Fruit Peel Hydroethanolic Extracts Prevent the Progress of Complete Freund’s Adjuvant-Induced Arthritis in Male Wistar Rats

Abstract

| This study was designed to assess the preventive effect of Citrus limon (C. lemon) and Citrus paradisi (C. paradisi) fruit peel hydroethanolic extracts on the progress of complete Freund's Adjuvant (CFA)-induced arthritis in male Wistar rats. Rheumatoid arthritis rat model was established by subcutaneous injection of 0.2 ml CFA into the right hind paw of each rat at two successive days. Arthritic rats were administered C.limon and C. paradisi fruit peel hydroethanolic extracts by oral gavage of 100 mg/kg body weight /day for 9 and 18 days. Administration of C. limon and C. paradisi fruit peel hydroethanolic extracts for 9 and 18 days, significantly reduced the CFA-induced paw swelling and edema in arthritic rats as manifested by a significant decrease in right hind paw circumference, volume and thickness. The increased mRNA expression of right ankle joint pro-inflammatory and inflammatory mediators including cyclooxygenase-1 (COX-1), interleukin-1β (IL-1β) and interleukin-6(IL-6) and the decreased mRNA expression of anti-inflammatory cytokine(IL-4) were significantly improved in arthritic rats by oral administration of C. limon and C. paradisi fruit peel hydroethanolic extracts. In association, the deleterious histological alterations represented by articular joint inflammatory cells infiltration, fibroblasts proliferation, edema, synovial hyperplasia, pannus formation and cartilage necrosis as well as spleen haemorrhage and lymphocytic necrosis and thymus lymphoblasts proliferation were noticeably alleviated by oral supplementation of arthritic rats with C. limon and C. paradisi fruit peel hydroethanolic extracts for 9 and 18 days. The study suggested that C. limon and C. paradisi fruit peel hydroethanolic extracts have anti-arthritic potentials which may be mediated via their anti-inflammatory activities.Citation | Ahmed OM, Ashour MB, Fahim HI, Ahmed NA (2018). Citrus limon and paradisi fruit peel hydroethanolic extracts prevent the progress of complete freund's adjuvant-induced arthritis in male wistar rats. Adv. Anim. Vet. Sci. 6(10): 443-455.

Ameliorative Effects of Bone Marrow-derived Mesenchymal Stem Cells and Hyaluronic Acid on Monosodium Iodoacetate-Induced Ankle Osteoarthritis in Wistar Rats: Roles of Th1/Th2/Th17 cytokines, MMP-13, TGF-β1 and antioxidant defense system

“…IL-17 has the potential to cause matrix damage and in ammation in OA patients [52]. The present results are also in accordance with Ahmed et al [9], Saber et al [51], Ahmed et al [53], Ahmed et al [54], and Zhang et al [55] who reported a signi cant drop in IL-4 expression in arthritic rats in relation to normal control.…”

Combinatory Effects of Bone Marrow-Derived Mesenchymal Stem Cells and Indomethacin on Adjuvant-Induced Arthritis in Wistar Rats: Roles of IL-1β, IL-4, Nrf-2, and Oxidative Stress

“…The primer sequences for β -actin mRNA are as follows: forward: 5′TCACCCTGAAGTACCCCATGGAG3′ and reverse: 5′TTGGCCTTGGGGTTCAGGGGG3′. All the primers used in this experiment were synthesized by Sangon Biotech (Shanghai, China) [ 21 ].…”

Medicinal plants used against various inflammatory biomarkers for the management of rheumatoid arthritis

“…[ 125 ] The various studies presented the therapeutic value of ethyl alcohol and methyl alcohol extract using plant bark part for treatment of RA at different doses orally administered against collagen type‐II‐induced arthritic mice, resulting in reducing free radical generation by lymphocytes along with inhibiting TNF‐α, CAII and all proteins involved in RA. [ 126,127 ] Citrus limon – The Citrus Limon commonly known as lemon belongs to Rutaceae family. The lemon peel extract comprises of bioactive compounds like pyrogallic acid, caffeic acid, eugenol and quercetin and when used at various doses suppresses the inflammation, and the usage of leaf extract of C. limon as therapy against Freund’s adjuvant arthritic model tends to reduce free radical level and acts as antioxidant by inhibition of xanthine oxidation.…”