Cigarette Smoke and Estrogen Signaling in Human Airway Smooth Muscle

Sathish, Venkatachalem; Freeman, Michele; Long, Emma; Thompson, Michael A.; Pabelick, Christina M.; Prakash, Y. S.

doi:10.1159/000430282

Cited by 41 publications

(35 citation statements)

References 66 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Two days after transfection, the cells were used for the experiment. As described previously [18], RT–PCR was performed to test the Nox2 mRNA expression. Nox2 primers were as follows: forward primer: ACTTCTTGGGTCAGCACTGG; reverse primer: ATTCCTGTCCAGTTGTCTTCG.…”

Section: Methodsmentioning

confidence: 99%

Curcumin Inhibits Heat-Induced Apoptosis by Suppressing NADPH Oxidase 2 and Activating the Akt/mTOR Signaling Pathway in Bronchial Epithelial Cells

Yuan

Tang

et al. 2017

Cell Physiol Biochem

View full text Add to dashboard Cite

Background: Heat causes bronchial epithelial cell apoptosis, which is a known factor contributing to airway damage during inhalation injury. Accumulating evidence has shown the effect of curcumin on inhibiting apoptosis. In this study, we investigated whether curcumin suppresses heat-induced apoptosis in bronchial epithelial cells and the underlying mechanism. Methods: Bronchial epithelial cell line 16HBE140 cells were incubated at either 42 °C, 47 °C, 52 °C, or 57 °C for 5 min in a cell incubator and then returned back to normal culture conditions (37 °C). An in vivo thermal inhalation injury rat model was established with a heat gun blowing hot air into the airway of rats. 16HBE140 cells and lung tissue were obtained for further study with or without curcumin treatment. Cell viability was determined by measuring the absorbance of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT). 2',7'-dichlorofluorescein diacetate fluorescence was used as a measure of reactive oxygen species (ROS) production. Levels of Bcl2, Bax, α-ATP, cleaved Poly (ADP-ribose) polymerase (PARP), cleaved caspase-3, gp91^phox, p47^phox, p67^phox, p22^phox, p40^phox, and Rac were determined by Western blotting. TUNEL staining was used to determine apoptosis. Results: Heat treatment triggered the apoptosis of 16HBE140 cells as shown by the increase in apoptosis molecular markers, including Bcl-2, Bax, cleaved PARP, and cleaved caspase-3. Administration of curcumin significantly inhibited apoptosis of 16HBE140 cells and suppressed the membrane translocation of NADPH oxidase 2 cytosolic components, as well as ROS production. Downregulation of Akt and mTOR phosphorylation induced by heat was also reversed by curcumin. Furthermore, we demonstrated that NADPH oxidase 2 is upstream of Akt/mTOR in heat-induced apoptosis. The protective role of curcumin on bronchial epithelia apoptosis was also confirmed in vivo by a rat inhalation injury model. Conclusion: This study demonstrates that one of the critical mechanisms underlying curcumin inhibiting heat-induced apoptosis is through suppressing NADPH Oxidase 2 and activating the Akt/mTOR signaling pathway in bronchial epithelial cells.

show abstract

Section: Methodsmentioning

confidence: 99%

Curcumin Inhibits Heat-Induced Apoptosis by Suppressing NADPH Oxidase 2 and Activating the Akt/mTOR Signaling Pathway in Bronchial Epithelial Cells

Yuan

Tang

et al. 2017

Cell Physiol Biochem

View full text Add to dashboard Cite

show abstract

“…Some studies have suggested the stimuli for regulation SIRT1 expression in bronchial epithelial cells. It has been reported that exposure to cigarette smoke is an important stimulus for asthma and leads to more asthma symptoms [27]. Pace et al found that stimulation with cigarette smoke extracts decreases the activity and levels of SIRT1 in 16HBE cells [28].…”

Section: Discussionmentioning

confidence: 99%

Suppression of Sirtuin-1 Increases IL-6 Expression by Activation of the Akt Pathway During Allergic Asthma

Tang

Chen

Meng

et al. 2017

Cell Physiol Biochem

View full text Add to dashboard Cite

Background/Aims: A growing number of studies have demonstrated that the activity and expression level of sirtuin-1 (SIRT1) are decreased in asthma patients; however, the mechanisms underlying decreased SIRT1 expression and function are still not completely understood. Interleukin (IL)-6 plays important roles in inflammation during allergic asthma. In this study, we examined whether loss of SIRT1 activity regulated the expression of IL-6 and further verified the underlying mechanisms. Methods: The human airway epithelial cell line 16HBE was used to test the effects of the SIRT1 inhibitor (salermide) on expression of IL-6. IL-6 mRNA and protein expression were assessed with real-time polymerase chain reaction (PCR), immunochemistry, and ELISA. OVA-challenged mice were used as an asthma model to investigate the effect of SIRT1 activation on IL-6 and relative Akt phosphorylation level. Results: We found that inhibition of SIRT1 increased IL-6 mRNA and protein levels in a time-dependent manner, which was accompanied by increased Akt pathway activation in 16HBE cells. Furthermore activation of Akt showed upregulated expression of the IL-6 protein whereas Akt inhibitor, LY294002 or Akt siRNA significantly inhibited SIRT1-regulated IL-6 expression. Conversely, activation of SIRT1 inhibited Akt activation and IL-6 expression in an asthmatic mice model and 16HBE cells. Conclusion: Our results indicate the potential role of SIRT1 in regulating inflammation by modulation of IL-6 expression in an Akt-dependent manner during allergic asthma.

show abstract

“…However, it remains unclear whether sex steroids are detrimental or beneficial in the airway. For example, we have demonstrated an acute bronchodilatory role for estrogen via effects on epithelial cells as well as ASM (Townsend et al, , ; Sathish et al, ). However, progesterone has been shown to increase airway hyperreactivity in sensitized male mice (Hellings et al, ), whereas testosterone exhibits bronchodilator effects similar to estrogen (Kouloumenta et al, ; Bordallo et al, ).…”

mentioning

confidence: 91%

Sex Steroids Influence Brain-Derived Neurotropic Factor Secretion From Human Airway Smooth Muscle Cells

et al. 2015

Self Cite

View full text Add to dashboard Cite

Brain derived neurotropic factor (BDNF) is emerging as an important player in airway inflammation, remodeling, and hyperreactivity. Separately, there is increasing evidence that sex hormones contribute to pathophysiology in the lung. BDNF and sex steroid signaling are thought to be intricately linked in the brain. There is currently little information on BDNF and sex steroid interactions in the airway, but is relevant to understanding growth factor signaling in the context of asthma in men vs. women. In this study, we assessed the effect of sex steroids on BDNF expression and secretion in human airway smooth muscle (ASM). Human ASM was treated with estrogen (E2) or testosterone (T, 10nM each) and intracellular BDNF and secreted BDNF measured. E2 and T significantly reduced secretion of BDNF; effects prevented by estrogen and androgen receptor inhibitor, ICI 182,780 (1uM) and flutamide (10uM), respectively. Interestingly, no significant changes were observed in intracellular BDNF mRNA or protein expression. High affinity BDNF receptor, TrkB, was not altered by E2 or T. E2 (but not T) significantly increased intracellular cyclic AMP levels. Notably, Epac1 and Epac2 expression were significantly reduced by E2 and T. Furthermore, SNARE complex protein SNAP25 was decreased. Overall, these novel data suggest that physiologically relevant concentrations of E2 or T inhibit BDNF secretion in human ASM, suggesting a potential interaction of sex steroids with BDNF in the airway that is different from brain. The relevance of sex steroid-BDNF interactions may lie in their overall contribution to airway diseases such as asthma.

show abstract

Cigarette Smoke and Estrogen Signaling in Human Airway Smooth Muscle

Cited by 41 publications

References 66 publications

Curcumin Inhibits Heat-Induced Apoptosis by Suppressing NADPH Oxidase 2 and Activating the Akt/mTOR Signaling Pathway in Bronchial Epithelial Cells

Curcumin Inhibits Heat-Induced Apoptosis by Suppressing NADPH Oxidase 2 and Activating the Akt/mTOR Signaling Pathway in Bronchial Epithelial Cells

Suppression of Sirtuin-1 Increases IL-6 Expression by Activation of the Akt Pathway During Allergic Asthma

Sex Steroids Influence Brain-Derived Neurotropic Factor Secretion From Human Airway Smooth Muscle Cells

Contact Info

Product

Resources

About