Chromosome mapping of the genes for murine arylamine <i>N</i>-acetyltransferases (NATs), enzymes involved in the metabolism of carcinogens: identification of a novel upstream noncoding exon for murine <i>Nat2</i>

Abstract

Arylamine N-acetyltransferases (NATs) catalyse acetylation reactions which can result in either detoxification or activation of arylamine carcinogens. The human NAT loci (NAT1, NAT2, and a pseudogene, NATP) have been mapped to human chromosome 8p22, a region frequently deleted in tumours. There are three functional genes in mice (Nat1, Nat2, and Nat3) encoding for three NAT isoenzymes. Different alleles at the Nat2 locus are responsible for the acetylation polymorphism identified in different mouse strains. We show that Nat3 is close to Nat1 and Nat2, by screening of a P1 artificial chromosome (PAC) library and provide cytogenetic evidence for co-localisation of the three genes in chromosome region 8 B3.1-B3.3. The Nat region of mouse and human is homologous. We also provide sequence information and a restriction map in the vicinity of Nat1 and Nat2 and describe a noncoding exon located 6 kb upstream of the Nat2 coding region.

Generation and analysis of mice with a targeted disruption of the arylamine N-acetyltransferase type 2 gene

“…This trend agrees with a recent report of Nat activities in different mouse strains, where total Nat-and Nat2-specific activities were compared in wild-type mice and mice that are slow Nat2 acetylators. 22 The Nat loci were predicted to be within 130 kb on mouse chromosome 8 at B3.1-3.3, 15 and recent genome analysis indicates that they are within 60 kb ( Figure 5). However, the construct within the Nat2 allele does not appear to alter the expression of the other Nat loci as determined from enzyme activity studies and the detection of protein from Western blots.…”

“…DNA was precipitated by the addition of an equal volume of isopropanol and spooled into 20 ml TE pH 8.0. The presence/absence of the targeted allele was determined using a PCR with primers mNAT2-1, mNAT2-910 and Neo-T. Amplification of the wild-type Nat2 allele (using mNAT2-1 and mNAT2-910 15 ) results in a product of 910 bp, whereas amplification of the Nat2* null allele (using mNat2-910 and Neo-T) (Neo-T sequence: 5 0 CATCGCCTTCTATCGCCTTCT3 0 , antisense, anneals in the neomycin cassette) results in a product of 500 bp ( Figure 1a(iv) and c). Under these PCR conditions, mNAT2-1 and mNAT2-910 were unable to amplify product from the Nat2*null allele because of the presence of the 5.2 kb replacement cassette.…”

“…10,12,13 In mice there are three Nat isoforms encoded at three loci, which have been located on chromosome 8. 14,15 In humans there are also three NAT loci, but the third locus is a pseudogene 16 and, in terms of substrate specificity and expression profile, murine Nat2, despite the nomenclature, is the homologue of human NAT1. [17][18][19] Murine Nat2 transcripts have been detected in embryonic stem (ES) cells as well as embryonic tissue beginning at gestational day 10.…”

Pharmacogenetics of the arylamine N-acetyltransferases

“…38,40 The localisation and genomic organisation of the mouse Nat genes is similar to their human counterparts. The three genes are clustered together in a 130-kb genomic region on mouse chromosome 8, cytogenetic band B3.1-B3.3 41 and within a genetic distance of about 31 cM from the centromere. 42 This chromosomal region is syntenic with the region harbouring the genes for human NAT on chromosome 8p.…”

“…It is of interest that mouse Nat2 also possesses a short non-coding exon, located about 6 kb upstream of the intronless open reading frame. 41 This raises the possibility that mouse Nat2 may be the genetic orthologue of the human NAT2 gene, although mouse NAT2 and human NAT1 proteins appear to be functionally equivalent.…”