Choice of selectable marker affects recombinant protein expression in cells and exosomes

Abstract

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

A shared, stochastic pathway mediates exosome protein budding along plasma and endosome membranes

“…The choice of HEK293 cells as our model system was based on several considerations, including its ease of culture, its extensive prior analysis, its non-cancer origin, and its recent emergence as the cell line of choice for human exosome engineering (114,(121)(122)(123)(124)(125). Furthermore, additional experiments using primary human cells indicates that HEK293 cells are a good model for exosome biogenesis in normal cells, as CD63, CD9, and CD81 were also highly enriched in exosomes produced by non-immortalized human mammary fibroblasts and dermal fibroblasts (supporting information, Fig.…”

“…Exosome engineering is an emerging field, critical to the design, testing, and manufacture of exosomes as vesicle standards, drug delivery vehicles, vaccines, and therapeutics (64,114,(121)(122)(123)(146)(147)(148)(149). Like all disciplines of engineering, success in exosome engineering requires a solid mechanistic understanding of the factors that determine exosome yield, content, and function.…”

“…Vectors for expressing WT and mutant forms of CD9 and CD63 were created by PCR amplification of the ORFs, followed by their insertion downstream of the CMV promoter in pcDNA3, with the structure of all amplified segments confirmed by DNA sequencing. For Cas9-mediated gene editing, we created the plasmid pFF, which contains the CMV promoter driving expression of a single long open reading frame that encodes (i) Cas93xNLS, (ii) a viral 2a peptide, (iii) EGFP, (iv) another viral 2a peptide, (v) the thymidine kinase (tk) from herpes simplex virus (HSV), (vi) another viral 2a peptide, and (vii) the puromycin resistance protein PuroR (123), all flanked by a pair of loxP sites. Into this plasmid, we inserted cassettes that carry two guide RNAexpressing genes, with each cassette designed to express gRNAs from the 7sk and H1 promoters that are specific for CD63 (pFF4, targeting 5'-GAGAGCCAGGGGTAGCCCCC-3' in exon 2), CD9 (pJM1084, targeting GCCCTCACCATGCCGGTCAA in coding exon 1 and 5'-GTCTATATTCTGATCGGAGC-3' in coding exon 3), Rab27a (pJM1085; targeting 5'-GCCCACTGTTGTGATAAATT-3' in exon 2 and 5'-ATATTTCTCTGCGAGTGCTA-3' in exon 4), and Alix (pFF3, 5'-GCGCGCTCGAGACGCTCCTG-3' and 5' -GACTGATGGGTACATTGACC-3') genes, respectively.…”

Degron tagging of BleoR and other antibiotic-resistance genes selects for higher expression of linked transgenes and improved exosome engineering

“…To determine whether destabilization domains could impact the levels of transgene expression, we generated pITRSB-based Sleeping Beauty transposons (12,19) that use cytomegalovirus (CMV) enhancer/promoter sequences to drive the expression of bicistronic ORFs (Fig. 1).…”

“…We recently reported that the choice of antibiotic resistance (AR) gene can also have a major impact on transgene expression (19). More specifically, we observed that each combination of antibiotic and AR gene/protein establishes a unique threshold of transgene expression below which no cell can survive, suggesting an inverse relationship between (i) the activity and/or stability of each dominant selectable marker protein and (ii) the average level of transgene expression across a population of antibiotic-resistant cell clones.…”