Chloroplast DNA phylogeography of Eucalyptus globulus

Freeman, Jules S.; Jackson, Hamish; Steane, Dorothy A.; McKinnon, GE; Dutkowski, GW; Potts, Brad M.; Vaillancourt, René E.

doi:10.1071/bt00094

Cited by 85 publications

(109 citation statements)

References 42 publications

Supporting

Mentioning

104

Contrasting

Order By: Relevance

“…Analysis of the extended hypervariable sequence, termed J LA + (Freeman et al 2001), found the distribution of major haplotype clades to be broadly consistent with that in the former study of E. globulus (Jackson et al 1999), but allowed for a greater resolution of the phylogenetic relationships between and within haplotype clades. A continental Australian origin of E. globulus was supported by the widespread distribution of the basal J Cg haplotypes on continental Australia.…”

Section: Introductionmentioning

confidence: 60%

“…A continental Australian origin of E. globulus was supported by the widespread distribution of the basal J Cg haplotypes on continental Australia. There was also evidence of glacial refugia in the coastal areas of eastern and south-eastern Tasmania, with the most recent seed migration of E. globulus between Tasmania and continental Australia occurring along a western island migration route during a glacial maximum and accompanying reduced sea level (Freeman et al 2001).…”

Section: Introductionmentioning

confidence: 99%

“…The extended J LA + region used previously by Freeman et al (2001) was further extended in the 5 direction in the present study. A forward primer (euro rpl2; GCGTCCTGTAG TAAGAGGAG) was designed to anneal to a conserved region 151 bp upstream of the forward primer rpl2 previously developed by Goulding et al (1996) and used in Freeman et al (2001).…”

Section: Chloroplast Dna Amplification and Sequencingmentioning

confidence: 99%

“…A forward primer (euro rpl2; GCGTCCTGTAG TAAGAGGAG) was designed to anneal to a conserved region 151 bp upstream of the forward primer rpl2 previously developed by Goulding et al (1996) and used in Freeman et al (2001). We used this primer, together with the reverse primer eucpsbA (eucpsbA; GGAGCAATAACCAACACTCTTG) developed by Freeman et al (2001).…”

Section: Chloroplast Dna Amplification and Sequencingmentioning

confidence: 99%

“…A subsequent study by Freeman et al (2001) expanded the sampling of E. globulus to a finer geographic resolution and extended the J LA region in the 3 direction to cover the complete trnH gene and the trnH-psbA intergenic spacer. Analysis of the extended hypervariable sequence, termed J LA + (Freeman et al 2001), found the distribution of major haplotype clades to be broadly consistent with that in the former study of E. globulus (Jackson et al 1999), but allowed for a greater resolution of the phylogenetic relationships between and within haplotype clades.…”

Section: Introductionmentioning

confidence: 99%

See 4 more Smart Citations

Chloroplast DNA phylogeography reveals the island colonisation route of Eucalyptus urophylla (Myrtaceae)

2007

View full text Add to dashboard Cite

Abstract. We present a study of the colonisation patterns of a tropical tree species among an island archipelago. Eucalyptus urophylla (S.T.Blake) is an economically important plantation species endemic to the volcanic slopes of seven islands in eastern Indonesia. In the present study, we investigated the geographical distribution of chloroplast DNA sequence variation in E. urophylla to gain insight into its historical seed-migration routes. DNA sequence data were obtained from 198 plants from which 20 haplotypes were identified. A moderate to high level of chloroplast genetic differentiation (G ST = 0.581, N ST = 0.724) and significant phylogeographic structure (N ST > G ST ; P < 0.01) were observed, suggesting low levels of recurrent seed-mediated gene flow among the islands. The highest levels of haplotype diversity were observed on the eastern islands of Wetar and Timor. The two most westerly islands, Flores and Lomblen, were fixed for what appeared to be the ancestral haplotype. Chloroplast haplotype diversity therefore exhibited a decreasing trend from east to west in the species' range, consistent with an east-to-west colonisation route across the seven islands. Environmental factors that may have contributed to the contemporary spatial distribution of chloroplast DNA haplotypes include island paleogeology, ocean currents, fluctuations in sea levels and possible hybridisation events.

show abstract

Section: Introductionmentioning

confidence: 60%

Section: Introductionmentioning

confidence: 99%

Section: Chloroplast Dna Amplification and Sequencingmentioning

confidence: 99%

Section: Chloroplast Dna Amplification and Sequencingmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

Chloroplast DNA phylogeography reveals the island colonisation route of Eucalyptus urophylla (Myrtaceae)

2007

View full text Add to dashboard Cite

show abstract

Multiple evolutionary processes drive the patterns of genetic differentiation in a forest tree species complex

Jones

Steane

Lavery³

et al. 2013

Ecology and Evolution

View full text Add to dashboard Cite

Forest trees frequently form species complexes, complicating taxonomic classification and gene pool management. This is certainly the case in Eucalyptus, and well exemplified by the Eucalyptus globulus complex. This ecologically and economically significant complex comprises four taxa (sspp. bicostata, globulus, maidenii, pseudoglobulus) that are geographically and morphologically distinct, but linked by extensive “intergrade” populations. To resolve their genetic affinities, nine microsatellites were used to genotype 1200 trees from throughout the natural range of the complex in Australia, representing 33 morphological core and intergrade populations. There was significant spatial genetic structure (FST = 0.10), but variation was continuous. High genetic diversity in southern ssp. maidenii indicates that this region is the center of origin. Genetic diversity decreases and population differentiation increases with distance from this area, suggesting that drift is a major evolutionary process. Many of the intergrade populations, along with other populations morphologically classified as ssp. pseudoglobulus or ssp. globulus, belong to a “cryptic genetic entity” that is genetically and geographically intermediate between core ssp. bicostata, ssp. maidenii, and ssp. globulus. Geography, rather than morphology, therefore, is the best predictor of overall genetic affinities within the complex and should be used to classify germplasm into management units for conservation and breeding purposes.

show abstract

Divergent lineages in a semi‐arid mallee species, Eucalyptus behriana, correspond to a major geographic break in southeastern Australia

Fahey

Fowler

McLay

et al. 2020

Ecology and Evolution

View full text Add to dashboard Cite

show abstract

Chloroplast DNA phylogeography of Eucalyptus globulus

Cited by 85 publications

References 42 publications

Chloroplast DNA phylogeography reveals the island colonisation route of Eucalyptus urophylla (Myrtaceae)

Chloroplast DNA phylogeography reveals the island colonisation route of Eucalyptus urophylla (Myrtaceae)

Multiple evolutionary processes drive the patterns of genetic differentiation in a forest tree species complex

Divergent lineages in a semi‐arid mallee species, Eucalyptus behriana, correspond to a major geographic break in southeastern Australia

Contact Info

Product

Resources

About