Chemical Syntheses of Oligodeoxyribonucleotides Containing Spore Photoproduct

Abstract

5-(α-Thyminyl)-5,6-dihydrothymine, also called spore photoproduct or SP, is commonly found in the genomic DNA of UV irradiated bacterial endospores. Despite the fact that SP was discovered nearly 50 years ago, its biochemical impact is still largely unclear due to the difficulty to prepare SP containing oligonucleotide in high purity. Here, we report the first synthesis of the phosphoramidite derivative of dinucleotide SP TpT, which enables successful incorporation of SP TpT into oligodeoxyribonucleotides with high efficiency via standard solid phase synthesis. This result provides the scientific community a reliable means to prepare SP containing oligonucleotides, laying the foundation for future SP biochemical studies. Thermal denaturation studies of the SP containing oligonucleotide found that SP destabilizes the duplex by 10–20 kJ/mole, suggesting that its presence in the spore genomic DNA may alter the DNA local conformation.

O6‐Alkylguanine DNA Alkyltransferase Repair Activity Towards Intrastrand Cross‐Linked DNA is Influenced by the Internucleotide Linkage

“…[30] The use of MSNT (MSNT = 1-(2-mesitylenesulfonyl)-3-nitro-1H-1,2,4-triazole) as the condensingr eagent favors attack by the 5'-OH,a so pposed to the 3'-OH, of the desilylated resi- due. [30][31][32] We hypothesized that these transformations would occur more quickly for our system,which we tested on starting material 4a.F irst, the desilylation reactionw as reduced to 1h (as opposed to 6h), andt he cyclization reaction time was reduced to 4hcompared to 16 hw ith no significant yield differences observed (51 %a nd 52 %f or shorter and longerr eaction times, respectively). For the heptylene analogue 4b,acyclization reaction time of 16 hw as used.…”

Spore photoproduct within DNA is a surprisingly poor substrate for its designated repair enzyme—The spore photoproduct lyase

“…To confirm that the SPL activity observed was due to substrate in the duplex oligomer, we studied SP TT repair in the ds 20-mer d(CTCGACACG[SP TT]CGCATGCCA)/d(TGGCATGCGAACGTGTCGAG). This duplex exhibits a T m of 64.6 °C, 28 indicating that > 99% of SP TT should be in the duplex form at 24°C. The HPLC chromatography was conducted at 60 °C to ensure a good separation of the two strands in this ds 20-mer.…”

“…40 We therefore synthesized a 13-mer d(CGTGA[SP TT]ACAGCC) using the SP TT phosphoramidite, 28 and studied its repair by SPL. As shown in Figure 5, the repair of SP TT results in a 6-mer and a 7-mer fragment; the repair efficiency by our SPL enzyme was found to be ~ 0.08 min −1 when the level of the 13-mer substrate was 2-fold higher than that of SPL.…”

“…31 The phosphoramidites for dinucleotide SP TpT and dinucleoside SP TT were prepared using our established procedure; syntheses of the SP-containing 10-mer and 20-mer oligonucleotides were conducted as described previously. 28 The 13-mer oligonucleotide containing SP TT was prepared using SP TT phosphoramidite and an ABI 3400 DNA/RNA synthesizer; the characterization of the resulting 13-nucleotide is shown in the Supporting Information. The sequences of the oligonucleotides used in this study are listed in Table 1.…”

“…Using the SP phosphoramidites developed in our group, 28 we are now able to incorporate dinucleotide SP TpT or dinucleoside SP TT into oligonucleotides under well-controlled local environments. Also, using DNA photoreaction in ice, 29 it is possible to prepare SP-containing plasmid or genomic DNA.…”