Chemical induction of hairpin RNAi molecules to silence vital genes in plant roots

Abstract

Understanding the functions encoded by plant genes can be facilitated by reducing transcript levels by hairpin RNA (hpRNA) mediated silencing. A bottleneck to this technology occurs when a gene encodes a phenotype that is necessary for cell viability and silencing the gene inhibits transformation. Here we compared the use of two chemically inducible plant promoter systems to drive hpRNA mediated gene silencing in transgenic, hairy roots. We cloned the gene encoding the Yellow Fluorescence Protein (YFP) into the dexamethasone inducible vector pOpOff2 and into the estradiol induced vector pER8. We then cloned a hpRNA targeting YFP under the regulation of the inducible promoters, transformed Medicago truncatula roots, and quantified YFP fluorescence and mRNA levels. YFP fluorescence was normal in pOpOff2 transformed roots without dexamethasone but was reduced with dexamethasone treatment. Interestingly, dexamethasone removal did not reverse YFP inhibition. YFP expression in roots transformed with pER8 was low even in the absence of inducer. We used the dexamethasone system to silence acetyl-CoA carboxylase gene and observed prolific root growth when this construct was transformed into Medicago until dexamethasone was applied. Our study shows that dexamethasone inducibility can be useful to silence vital genes in transgenic roots.

A Theophylline-Responsive Riboswitch Regulates Expression of Nuclear-Encoded Genes

“…Hence, we conclude that ligand-inducible aptazymes can be used effectively as artificial genetic switches in plants. Alternative systems based on the inducible expression of RNAi constructs or artificial microRNAs achieved reductions of transcript levels by 60% to 85% (Ó'Maoileidigh et al, 2015;Liu and Yoder, 2016;Thomson et al, 2017). However, in some cases, no efficient silencing was observed, and the targeted genes tended to remain silenced after inducer withdrawal (Ó'Maoileidigh et al, 2015;Liu and Yoder, 2016).…”

“…Alternative systems based on the inducible expression of RNAi constructs or artificial microRNAs achieved reductions of transcript levels by 60% to 85% (Ó'Maoileidigh et al, 2015;Liu and Yoder, 2016;Thomson et al, 2017). However, in some cases, no efficient silencing was observed, and the targeted genes tended to remain silenced after inducer withdrawal (Ó'Maoileidigh et al, 2015;Liu and Yoder, 2016). Because RNAi-based systems for gene silencing involve the generation and amplification of siR-NAs by the targeted cells, they are difficult to tune.…”

A theophylline-responsive riboswitch regulates expression of nuclear-encoded genes in Arabidopsis

“…Alternative systems based on the inducible expression of RNAi constructs or artificial microRNAs achieved reductions of transcript levels by 60% to 85% (O’Maoileidigh et al, 2015; Liu and Yoder, 2016; Thomson et al, 2017). However, in some cases, no efficient silencing was observed and the targeted genes tended to remain silenced after inducer withdrawal (O’Maoileidigh et al, 2015; Liu and Yoder, 2016). Because RNAi-based systems for gene silencing involve the generation and amplification of siRNAs by the targeted cells, they are difficult to tune.…”

Rpa1 mediates an immune response to avrRpm1Psa and confers resistance against Pseudomonas syringae pv. actinidiae

“…The coding sequence of Rpa1 was amplified from N. tabacum cDNA and cloned into pGWB vectors under the 35S promoter (Nakagawa et al , ). A 373‐bp YFP fragment (Liu and Yoder, ) was used in the control silencing construct hpYFP. A 150‐bp NbRIN4 fragment was amplified by PCR using a primer pair (sequence: CCAATCTTACTCCCCCACCT and AATTAGCATACTGCCGAAAATCA) from N. benthamiana cDNA to construct the hairpin hpNbRIN4.…”