Characterization of the promoter of the Brugia malayi 12kDa small subunit ribosomal protein (RPS12) gene

Oliveira, Ana de; Katholi, Charles R.; Unnasch, Thomas R.

doi:10.1016/j.ijpara.2008.02.002

Cited by 14 publications

(32 citation statements)

References 13 publications

(29 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…This method has been used to map the core promoter sequences of a number of different B. malayi genes (Shu et al, 2003; Higazi et al, 2005; de Oliveira et al, 2008; Liu et al, 2009) and to demonstrate that synthetic genes containing an ecdysone response element recognized by the B. malayi homologue of the ecdysone receptor are responsive to ecdysone in vivo (Tzertzinis et al, 2010). Biolistic transient transfection of isolated embryos has also been used to explore the sequences necessary and sufficient to support trans-splicing of B. malayi premRNAs in vivo (Higazi and Unnasch, 2004; Liu et al, 2007, 2010).…”

Section: Introductionmentioning

confidence: 99%

In vivo transfection of developmentally competent Brugia malayi infective larvae

Liu

Tzertzinis

et al. 2011

International Journal for Parasitology

Self Cite

View full text Add to dashboard Cite

Transient transfection of isolated Brugia malayi embryos by biolistics has proven to be useful in defining promoter structure and function in this parasite. However, isolated transfected embryos are developmentally incompetent. A method of producing developmentally competent transfected parasites is therefore needed. We report that L3 parasites can be chemically transfected in situ in the peritoneal cavity of a gerbil with a construct consisting of a secreted luciferase reporter gene containing a promoter, the 3' untranslated region and first intron derived from the B. malayi 70kDa heat shock protein gene. The in situ chemically transfected parasites are developmentally competent, producing adult parasites with an efficiency similar to that obtained from implanted untreated L3s. Cultured adult parasites and progeny microfilariae (mf) derived from L3s transfected with this construct secreted luciferase into the culture medium. When the transfected mf were fed to mosquitoes and the resulting L3s collected, the L3s also secreted luciferase into the culture medium. Progeny mf from transgenic adult parasites contained transgenic DNA, and the transgenic mRNA produced in these parasites was found to be correctly cis-and trans-spliced. In situ chemical transformation thus results in developmentally competent transfected B. malayi in which the transgenic sequences remain transcriptionally active in all life cycle stages and are present in the subsequent generation.

show abstract

Section: Introductionmentioning

confidence: 99%

In vivo transfection of developmentally competent Brugia malayi infective larvae

Liu

Tzertzinis

et al. 2011

International Journal for Parasitology

Self Cite

View full text Add to dashboard Cite

show abstract

“…Cloning of the promoters of the BmHSP70, BmRPL13 and BmRPS4 genes have been previously described [19, 21, 22]. To clone the promoter of the BmMFSP gene, the region located 1194 nt upstream of the predicted open reading frame of the BmMFSP gene was amplified from B. malayi genomic DNA by PCR using a high fidelity DNA polymerase and the primers MFSPc (5′ GGGAACTTTACAGGAAACACAG 3′) and MFSPnc (5′ TCTCTCCTCACACTTTCTGAGAA 3′) using previously described reaction conditions [22].…”

Section: Methodsmentioning

confidence: 99%

“…Transfected embryos, although developmentally incompetent, may be maintained in culture for several days [18]. This system has been used demonstrate that the core domains of many B. malayi promoters are exceptional [19–21]. In place of canonical CAAT and TATA box elements located roughly 30nt upstream of the start site of transcription, the core of the B. malayi promoters analyzed to date is localized to a pyrimidine rich region located just upstream of the spliced leader addition site [22].…”

Section: Introductionmentioning

confidence: 99%

Analysis of transcriptional regulation of tetracycline responsive genes in Brugia malayi

Liu

Kelen

Ghedin

et al. 2011

Molecular and Biochemical Parasitology

Self Cite

View full text Add to dashboard Cite

The Wolbachia endosymbiont of the human filarial parasites is necessary for parasite reproduction, making it an attractive chemotherapeutic target. Previous studies have demonstrated that mRNA levels of several nuclearly encoded genes are altered as a result of exposure to antibiotics that eliminate the endosymbiont, suggesting that they may be involved in maintaining the parasite-endosymbiont relationship. Here, we tested the hypothesis that the increase in mRNA levels of certain nuclearly encoded genes of Brugia malayi in response to tetracycline treatment involved specific regulatory elements present in the promoters of these genes. The promoters of three such genes (BmRPL13, BmRPS4 and BmHSP70) were tested for tetracycline responsiveness utilizing a homologous transient transcription system. Reporter gene expression driven by all three promoters was up-regulated in transfected embryos exposed to tetracycline. Substitution mutagenesis was employed to map the cis-acting elements responsible for this response in the BmHSP70 promoter. Tetracycline responsiveness was found to be distinct from the cis-acting elements involved in regulating the stress response from the BmHSP70 promoter; rather, tetracycline responsiveness was mediated by a TATAA-box like element. This study represents the first demonstration of small molecule-mediated gene regulation of a native B. malayi promoter.

show abstract

“…Although transient transfection and transgenesis have found application in a number of studies of gene function and regulation in parasitic nematodes (Unnasch et al 1999; Higazi et al 2002, 2005; Higazi and Unnasch, 2004; Oliveira et al 2008; Castelletto et al 2009; Liu et al 2010 b ; Tzertzinis et al 2010; Bailey et al 2011), transgenesis will only become a robust functional genomic tool when it becomes generally practical to derive stable transgene-expressing lines of parasitic nematodes. This goal has been technically accomplished in P. trichosuri which, by virtue of its ability to cycle continuously in free-living culture, has allowed stable transgene-expressing lines to be established by culture passage and transferred to the possum host for future study (Grant et al 2006 a ).…”

Section: Possible Fates and Modes Of Inheritance Of Administered Tranmentioning

confidence: 99%

Nucleic acid transfection and transgenesis in parasitic nematodes

Lok

2011

Parasitology

View full text Add to dashboard Cite

SUMMARY Transgenesis is an essential tool for assessing gene function in any organism, and it is especially crucial for parasitic nematodes given the dwindling armamentarium of effective anthelmintics and the consequent need to validate essential molecular targets for new drugs and vaccines. Two of the major routes of gene delivery evaluated to date in parasitic nematodes, bombardment with DNA-coated microparticles and intragonadal microinjection of DNA constructs, draw upon experience with the free-living nematode Caenorhabditis elegans. Bombardment has been used to transiently transfect Ascaris suum, Brugia malayi and Litomosoides sigmodontis with both RNA and DNA. Microinjection has been used to achieve heritable transgenesis in Strongyloides stercoralis, S. ratti and Parastrongyloides trichosuri and for additional transient expression studies in B. malayi. A third route of gene delivery revisits a classic method involving DNA transfer facilitated by calcium-mediated permeabilization of recipient cells in developing B. malayi larvae and results in transgene inheritance through host and vector passage. Assembly of microinjected transgenes into multi-copy episomal arrays likely results in their transcriptional silencing in some parasitic nematodes. Methods such as transposon-mediated transgenesis that favour low-copy number chromosomal integration may remedy this impediment to establishing stable transgenic lines. In the future, stable transgenesis in parasitic nematodes could enable loss-of-function approaches by insertional mutagenesis, in situ expression of inhibitory double-stranded RNA or boosting RNAi susceptibility through heterologous expression of dsRNA processing and transport proteins.

show abstract

Characterization of the promoter of the Brugia malayi 12kDa small subunit ribosomal protein (RPS12) gene

Cited by 14 publications

References 13 publications

In vivo transfection of developmentally competent Brugia malayi infective larvae

In vivo transfection of developmentally competent Brugia malayi infective larvae

Analysis of transcriptional regulation of tetracycline responsive genes in Brugia malayi

Nucleic acid transfection and transgenesis in parasitic nematodes

Contact Info

Product

Resources

About