Characterization of the Gene Cluster Responsible for Cylindrospermopsin Biosynthesis

Mihali, Troco Kaan; Kellmann, Ralf; Muenchhoff, Julia; Barrow, Kevin D.; Neilan, Brett A.

doi:10.1128/aem.01988-07

Cited by 261 publications

(283 citation statements)

References 50 publications

Supporting

Mentioning

263

Contrasting

Unclassified

Order By: Relevance

“…A polyketide synthase (PKS) encoding gene (anaF) of the anatoxin gene cluster was amplified using the primer atxoaf (Ballot et al 2010a) and the newly designed primer atxoar (acctccgactaaagctaggtcg). Amplification of the cyrJ gene fragment was conducted using the primers cynsulfF and cylnamR (Mihali et al 2008). The primers sxtaf and sxtar were used to amplify a part of the sxtA gene of the saxitoxin gene cluster (Ballot et al 2010b).…”

Section: Isolation Of Strains and Morphological Characterisationmentioning

confidence: 99%

Diversity of cyanobacteria and cyanotoxins in Hartbeespoort Dam, South Africa

Ballot

Sandvik

Rundberget

et al. 2014

Mar. Freshwater Res.

View full text Add to dashboard Cite

Abstract. The South African Hartbeespoort Dam is known for the occurrence of heavy Microcystis blooms. Although a few other cyanobacterial genera have been described, no detailed study on those cyanobacteria and their potential toxin production has been conducted. The diversity of cyanobacterial species and toxins is most probably underestimated. To ascertain the cyanobacterial composition and presence of cyanobacterial toxins in Hartbeespoort Dam, water samples were collected in April 2011. In a polyphasic approach, 27 isolated cyanobacterial strains were classified morphologically and phylogenetically and tested for microcystins (MCs), cylindrospermopsin (CYN), saxitoxins (STXs) and anatoxin-a (ATX) by liquid chromatography-tandem mass spectrometry (LC-MS/MS) and screened for toxin-encoding gene fragments. The isolated strains were identified as Sphaerospermopsis reniformis, Sphaerospermopsis aphanizomenoides, Cylindrospermopsis curvispora, Raphidiopsis curvata, Raphidiopsis mediterrranea and Microcystis aeruginosa. Only one of the Microcystis strains (AB2011/53) produced microcystins (35 variants). Forty-one microcystin variants were detected in the environmental sample from Hartbeespoort Dam, suggesting the existence of other microcystin producing strains in Hartbeespoort Dam. All investigated strains tested negative for CYN, STXs and ATX and their encoding genes. The mcyE gene of the microcystin gene cluster was found in the microcystin-producing Microcystis strain AB2011/53 and in eight non-microcystin-producing Microcystis strains, indicating that mcyE is not a good surrogate for microcystin production in environmental samples.

show abstract

Section: Isolation Of Strains and Morphological Characterisationmentioning

confidence: 99%

Diversity of cyanobacteria and cyanotoxins in Hartbeespoort Dam, South Africa

Ballot

Sandvik

Rundberget

et al. 2014

Mar. Freshwater Res.

View full text Add to dashboard Cite

show abstract

“…The ps (aoaB/cyrB) gene spans 8.7 kb and catalyzes a step in the CYN synthesis. It encodes a PKS/ NRPS hybrid [37]. The pks (aoaC/cyrC) gene spans 5.0 kb and encodes a PKS [36].…”

Section: Discussionmentioning

confidence: 99%

Isolation and preliminary characterization of cyanobacteria strains from freshwaters of Greece

2014

View full text Add to dashboard Cite

Cyanobacterial harmful algal blooms (or CyanoHABs) represent one of the most conspicuous waterborne microbial hazards. The characterization of the bloom communities remains problematic because the cyanobacterial taxonomy of certain genera has not yet been resolved. In this study, 29 planktic and benthic cyanobacterial strains were isolated from freshwaters located in Greece. The strains were assigned to the genera Chroococcus, Microcystis, Synechococcus, Jaaginema, Limnothrix, Pseudanabaena, Anabaena, and Calothrix and screened for the production of the cyanotoxins microcystins (MCs), cylindrospermopsins (CYNs), and saxitoxins (STXs) using molecular (PCR amplification of seven genes implicated in cyanotoxin biosynthesis) and immunological (ELISA) methods. This study presents, for the first time, a cyanobacteria culture collection from Greece, thus providing missing study material for the understanding of bloom formation and cyanotoxin production in the Mediterranean and for the polyphasic characterization of important components of the phytoplankton. The combined use of molecular and immunochemical methods allowed the identification of MC producing strains, but further data are needed for CYNand STX-producing cyanobacteria. The high percentage of MC-producing Microcystis strains in the urban Lakes Kastoria and Pamvotis, frequently used for agriculture irrigation, fishing and recreation, highlights the potential risk for human health.

show abstract

“…Even though the mechanisms of CYN release from the producing cells are still not completely understood, recently Mihali et al (2008) suggested CyrK to be a transporter for CYN. In the field, the observation of high extracellular concentrations has been distinctive for this toxin.…”

Section: Introductionmentioning

confidence: 99%

Advances in solid phase extraction of the cyanobacterial toxin cylindrospermopsin

Wörmer

Carrasco

Cirés

et al. 2009

Limnology & Ocean Methods

View full text Add to dashboard Cite

Unlike other cyanotoxins, cylindrospermopsin (CYN) is often found in high concentrations in the extracellular fraction, possibly due to a higher release from the producing cells and a limited degradation once liberated. This fact demands effective recovery methods from environmental samples to guarantee a proper quantification. A reliable and simple solid phase extraction (SPE) method was obtained by the sole use of graphitized carbon cartridges and by paying special attention to both the selection of the most suitable solvent and the need of sample preparation prior to SPE. An acidified combination of dichloromethane and methanol not only showed best recoveries, but also allowed drastic reduction to the elution volumes needed with complete recovery being achieved in only 8 mL. Acidification of the sample and addition of sodium chloride are suggested as valuable improvements to the SPE method and turn out to be essential for correct and robust recovery of CYN in environmental samples of great diversity in terms of pH, DOC, and conductivity. Excellent behavior of the proposed method over a wide range of CYN loadings, applied sample volumes, and DOC loadings was also confirmed.

show abstract

Characterization of the Gene Cluster Responsible for Cylindrospermopsin Biosynthesis

Cited by 261 publications

References 50 publications

Diversity of cyanobacteria and cyanotoxins in Hartbeespoort Dam, South Africa

Diversity of cyanobacteria and cyanotoxins in Hartbeespoort Dam, South Africa

Isolation and preliminary characterization of cyanobacteria strains from freshwaters of Greece

Advances in solid phase extraction of the cyanobacterial toxin cylindrospermopsin

Contact Info

Product

Resources

About