Characterization of Extraintestinal Escherichia coli Isolated from a Peacock (Pavo cristatus) With Colisepticemia

Barbieri, Nicolle Lima; Tejkowski, Thiago Moreira; Oliveira, Aline Luísa de; Brito, Benito Guimarães de; Horn, Fabiana

doi:10.1637/10116-992112-digest.1

Cited by 1 publication

(5 citation statements)

References 0 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The primers used in this analysis were previously described in literature, being: 5'–TGGTTGCGAAGGAATTTACC‐3' and 5'–CTGACATCAACTTGCAAACAAA–3' for stx1 (Barbieri et al . 2012); 5'–TCCCGGGAGTTTACGATAGA–3' and 5'–AAACGCGCCTGATAGACATC–3' for stx2 (Barbieri et al . 2012); 5'–ACCTGCACAGGGCAATGTAG–3') and 5'–TCAGCATACGGATTCTGCAC–3' tir of EHEC (Barbieri et al .…”

Section: Methodsmentioning

confidence: 99%

“…2012); 5'–TCCCGGGAGTTTACGATAGA–3' and 5'–AAACGCGCCTGATAGACATC–3' for stx2 (Barbieri et al . 2012); 5'–ACCTGCACAGGGCAATGTAG–3') and 5'–TCAGCATACGGATTCTGCAC–3' tir of EHEC (Barbieri et al . 2012); 5'–GAACTTCAAATCCTCCAAGCA–3' and 5'–TCATTGTTTTCTCCCCTGAG–3' for tir of EPEC (Barbieri et al .…”

Section: Methodsmentioning

confidence: 99%

“…2012); 5'–ACCTGCACAGGGCAATGTAG–3') and 5'–TCAGCATACGGATTCTGCAC–3' tir of EHEC (Barbieri et al . 2012); 5'–GAACTTCAAATCCTCCAAGCA–3' and 5'–TCATTGTTTTCTCCCCTGAG–3' for tir of EPEC (Barbieri et al . 2012); and 5'–ACTGGACTTCTTATTRCCGTTCTATG–3' and 5'–CTAAGCGGGTATTGTTACCAGA–3' for Eaf sequence (Hardegen et al .…”

Section: Methodsmentioning

confidence: 99%

“…2012); 5'–GAACTTCAAATCCTCCAAGCA–3' and 5'–TCATTGTTTTCTCCCCTGAG–3' for tir of EPEC (Barbieri et al . 2012); and 5'–ACTGGACTTCTTATTRCCGTTCTATG–3' and 5'–CTAAGCGGGTATTGTTACCAGA–3' for Eaf sequence (Hardegen et al . 2010).…”

Section: Methodsmentioning

confidence: 99%

“…The PCR reactions were prepared in 25 µl, using 1 U GoTaq DNA polymerase (Promega, USA), 10 buffer, 1 mM dNTPs and pmol of each primer. The primers used in this analysis were previously described in literature, being: 5'-TGGTTGCG AAGGAATTTACC-3' and 5'-CTGACATCAACTTGCAAA CAAA-3' for stx1 (Barbieri et al 2012); 5'-TCCCGGGA GTTTACGATAGA-3' and 5'-AAACGCGCCTGATAGAC ATC-3' for stx2 (Barbieri et al 2012); 5'-ACCTGCACAG GGCAATGTAG-3') and 5'-TCAGCATACGGATTCTG CAC-3' tir of EHEC (Barbieri et al 2012); 5'-GAACTTCAAATCCTCCAAGCA-3' and 5'-TCATTGTTTT CTCCCCTGAG-3' for tir of EPEC (Barbieri et al 2012); and 5'-ACTGGACTTCTTATTRCCGTTCTATG-3' and 5'-CTAAGCGGGTATTGTTACCAGA-3' for Eaf sequence (Hardegen et al 2010). Template DNA was added after 100-fold dilution to the reactions.…”

Section: E Coli Pathotypes Identificationmentioning

confidence: 99%

See 4 more Smart Citations

Wild capybaras as reservoir of shiga toxin-producing Escherichia coli in urban Amazonian Region

Breyer

Carli

Vieira

et al. 2022

Letters in Applied Microbiology

View full text Add to dashboard Cite

Capybaras are rodent widely distributed in South America, which inhabit lakeside areas including ecological parks and urban sites. Due to anthropological interaction, monitoring zoonotic pathogens in wildlife is essential for One Health. We investigated faecal samples from capybaras living in an urban area in Rio Branco (Acre, Brazil) for the presence diarrhoeagenic E. coli. Virulence factors from shiga toxin‐producing E. coli (STEC), enterohaemorrhagic E. coli (EHEC), and enteropathogenic E. coli (EPEC) were screened by PCR. We detected at least one virulence factor in 81% of the animals, being classified as STEC and EHEC pathotypes. The presence of zoonotic E. coli in capybaras is a warning due to the highly frequent anthropological interactions with wild animals in this area. Our findings highlight the importance of investigating wild animals as carriers of zoonotic E. coli, requiring further investigations into wildlife surveillance and epidemiological monitoring.

show abstract

Section: Methodsmentioning

confidence: 99%