Characterization of extended-spectrum  -lactamase-producing isolates of Haemophilus parainfluenzae

Tristram, Stephen; Pitout, M.J.; Forward, Kevin R.; Campbell, Sandra J.; Nichols, Scott C.; Davidson, Ross

doi:10.1093/jac/dkm523

Cited by 35 publications

(26 citation statements)

References 20 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…3,6 Although H. parainfluenzae is often resistant to b-lactam antibiotics, its mechanisms of resistance to this class of antibiotics have received little attention. The BLNAR mechanism has been very rarely reported in H. parainfluenzae, 7 and, to our knowledge, the production of inhibitor-resistant TEM (IRT) b-lactamases has not been described in clinical isolates of Haemophilus spp., although their effect has been studied in artificially produced recombinant strains. 8 Accordingly, the aims of this study were to determine the mechanisms of resistance to b-lactam antibiotics in clinical isolates of H. parainfluenzae and to elucidate the impact that b-lactam resistance genotypes have on the antibiotic susceptibility of H. parainfluenzae.…”

Section: Introductionmentioning

confidence: 90%

“…Due to the high degree of nucleotide (78%) and amino acid (83%) homology between ftsI and PBP3 of H. influenzae Rd KW20 and H. parainfluenzae T3T1, 7,13 we used the same genotype classification as that already used for H. influenzae, 3,15 as follows: gBLNAS, b-lactamase-negative isolates that are ampicillin susceptible without resistance mechanisms; gBLNAR, b-lactamase-negative isolates with PBP3 amino acid substitutions causing reduced susceptibility to ampicillin (defined by either an Asn526 or an Arg517 substitution); gBLPAR, b-lactamase-positive isolates that are ampicillin resistant without gBLNAR-defining PBP3 amino acid substitutions; and gBLPACR, b-lactamase-positive isolates also presenting PBP3 amino acid substitutions.…”

Section: Genotype Definitionmentioning

confidence: 99%

“…Numbering was based on the ftsI sequence of H. parainfluenzae. 13 The following primers were used: paraF2 5 ′ CGTAACCGTGCGATTACGGATACCT, designed in this study, and paraR2 5 ′ TGCTAGAGAATACCGGGGCAG (nt 943-1708); 7 and paraF3 5 ′ CAGCGAGACGTGATGAAGT with paraR3 5 ′ GTTTTTTCTGTT GGTTCTGC (nt 1025-1750). PCR was carried out as described for H. influenzae.…”

mentioning

confidence: 99%

See 2 more Smart Citations

Novel mechanisms of resistance to β-lactam antibiotics in Haemophilus parainfluenzae: β-lactamase-negative ampicillin resistance and inhibitor-resistant TEM β-lactamases

García-Cobos¹,

Arroyo²,

Campos³

et al. 2013

Journal of Antimicrobial Chemotherapy

View full text Add to dashboard Cite

Objectives: To determine the mechanisms of resistance to b-lactam antibiotics in clinical isolates of Haemophilus parainfluenzae.Methods: Twenty clinical isolates of H. parainfluenzae with decreased susceptibility to aminopenicillins were examined and compared with a control group of 20 fully susceptible isolates. In this collection, the presence of amino acid substitutions in the transpeptidase domain of penicillin-binding protein 3 (PBP3), b-lactamase production and the surrounding genetic regions of bla TEM genes in selected isolates were analysed.Results: Of the 20 non-susceptible isolates, 8 produced TEM b-lactamase (gBLPAR), 7 had mutations in the transpeptidase domain of the ftsI gene related to decreased susceptibility to b-lactams (gBLNAR) and 5 had both resistance mechanisms (gBLPACR). No resistance mechanisms were identified in the susceptible control group (gBLNAS). gBLNAR isolates had MIC 90 values 4-to 16-fold higher than gBLNAS isolates for ampicillin, amoxicillin/clavulanic acid, cefuroxime, cefotaxime and cefixime, and the most common PBP3 mutation was Asn526Ser. The additional Ser385Thr substitution (III-like group) may confer decreased susceptibility to cefotaxime, cefixime and aztreonam, as in Haemophilus influenzae. In two b-lactamase-positive isolates without PBP3 mutations, the inhibitor-resistant TEM (IRT) b-lactamases TEM-34 and the novel TEM-182 were detected and carried by a TnA transposon of the Tn2 type; both isolates had an amoxicillin/clavulanic acid MIC of ≥8 mg/L. The TnA transposons of two b-lactamase-positive isolates were inserted between the tfc20 and tfc21 genes, typically associated with integrative and conjugative elements in Haemophilus spp.; the TEM-34 IRT b-lactamase was harboured in a 5.5 kb plasmid. Conclusions:Clinical isolates of H. parainfluenzae express a variety of aminopenicillin resistance mechanisms, either alone or in combination, including PBP3 modifications, bla TEM-1 and IRT b-lactamase production.

show abstract

Section: Introductionmentioning

confidence: 90%

Section: Genotype Definitionmentioning

confidence: 99%

mentioning

confidence: 99%

See 1 more Smart Citation

Novel mechanisms of resistance to β-lactam antibiotics in Haemophilus parainfluenzae: β-lactamase-negative ampicillin resistance and inhibitor-resistant TEM β-lactamases

García-Cobos¹,

Arroyo²,

Campos³

et al. 2013

Journal of Antimicrobial Chemotherapy

View full text Add to dashboard Cite

show abstract

“…In contrast, little attention has been paid to Haemophilus parainfluenzae. Only a few BLNAR and/or TEM-producing isolates have been described (4,5), and those with resistance to quinolones are rarely reported (6,7). To our knowledge, MDR H. parainfluenzae isolates (e.g., simultaneously resistant to ␤-lactams, quinolones, and macrolides) have never been found.…”

mentioning

confidence: 95%

Emergence of Extensively Drug-Resistant Haemophilus parainfluenzae in Switzerland

Tinguely

Seiffert

Furrer

et al. 2013

Antimicrob Agents Chemother

View full text Add to dashboard Cite

Two homosexual men were colonized in the urethra with Haemophilus parainfluenzae nonsusceptible to ampicillin (MIC, 8 g/ ml), amoxicillin-clavulanate (MIC, 4 g/ml), cefotaxime (MIC, 1.5 g/ml), cefepime (MIC, 3 g/ml), meropenem (MIC, 0.5 g/ ml), cefuroxime, azithromycin, ciprofloxacin, tetracycline, and chloramphenicol (all MICs, >32 g/ml). Repetitive extragenic palindromic PCR (rep-PCR) showed that the strains were indistinguishable. The isolates had amino acid substitutions in PBP3, L4, GyrA, and ParC and possessed Mef(A), Tet(M), and CatS resistance mechanisms. This is the first report of extensively drugresistant (XDR) H. parainfluenzae.

show abstract

“…27 The β-lactamases detected include the TEM-1 and TEM-15 types, which are usually associated with plasmids. 14,16,28,29 It was reported that the plasmid that carried the TEM-1 β-lactamase was identical to one isolated from 'Africantype' penicillinase-producing Neisseria gonorrhoeae strain. 26,30 Inhibitor resistant β-lactamases TEM-34 and TEM-182, which were both carried by TnA transposon of the Tn2 type, were also detected in H. parainfluenzae in 2011.…”

Section: β-Lactam Antibioticsmentioning

confidence: 99%

Mechanisms of antibiotic resistance inHaemophilus parainfluenzae

Abotsi

Govinden

Essack

2017

Southern African Journal of Infectious Diseases

View full text Add to dashboard Cite

Haemophilus parainfluenzae is part of the HACEK group of fastidious bacteria commonly implicated in endocarditis and bacteremia. Previously considered as a normal respiratory, oral and sometimes genitourinary commensal, it has been recognised as a pathogen that can cause life-threatening infections in both immunocompromised and healthy individuals. It has also been reported as a bacterium that can harbor transferable antibiotic resistance genes. This paper presents a literature review on the molecular mechanisms of resistance of H. parainfluenzae to commonly prescribed antibiotics and discusses areas for further research.

show abstract

Characterization of extended-spectrum -lactamase-producing isolates of Haemophilus parainfluenzae

Abstract: The high-level cefotaxime resistance in the H. parainfluenzae isolates was due to a combination of a plasmid-mediated TEM-15 extended-spectrum beta-lactamase with altered PBP3 probably contributing. Other contributing resistance mechanisms could not be excluded.

Cited by 35 publications

References 20 publications

Novel mechanisms of resistance to β-lactam antibiotics in Haemophilus parainfluenzae: β-lactamase-negative ampicillin resistance and inhibitor-resistant TEM β-lactamases

Novel mechanisms of resistance to β-lactam antibiotics in Haemophilus parainfluenzae: β-lactamase-negative ampicillin resistance and inhibitor-resistant TEM β-lactamases

Emergence of Extensively Drug-Resistant Haemophilus parainfluenzae in Switzerland

Mechanisms of antibiotic resistance inHaemophilus parainfluenzae

Contact Info

Product

Resources

About