Characterization of EST3: a metagenome-derived esterase with suitable properties for biotechnological applications

Abstract

Metagenomic libraries from diverse environments have been extensive sources of many lipases and esterases; nevertheless, most of these enzymes remain biochemically uncharacterized. We previously built a metagenomic fosmid library from a microbial consortium specialized for diesel oil degradation and tested it for lipolytic activity. In the present study, we identified the PL14.H10 clone that was subcloned and sequenced, which enabled the identification of the EST3 protein. This enzyme exhibited 74 % amino acid identity with the uncharacterized alpha/beta hydrolase from Parvibaculum lavamentivorans [GenBank: WP012110575.1] and was classified into lipolytic enzyme family IV. Biochemical characterization revealed that EST3 presents high activity in a wide range of temperature with highest activity from 41 to 45 °C. Also, this thermostable esterase acts from mild acidic to alkaline conditions with an optimum pH of 6.0. The enzyme exhibited activity against p-nitrophenyl esters of different chain lengths and highest catalytic efficiency against p-nitrophenyl caprylate. The activity of the protein was increased in the presence of 0.5 mM of Mn(+2), Li(+), EDTA, and 1 % of CTAB and exhibited half of the activity in the presence of 10 % methanol and ethanol. Moreover, the homology model of EST3 was built and compared to other esterases, revealing a substrate channel that should fit a wide range of substrates. Taken together, the data presented in this work reveal the unique and interesting characteristics of EST3 that might be explored for further use in biotechnological applications.

Conversion of a Monascus ruber esterase into a lipase by disrupting a salt bridge

“…10 ␣-helix to close the substrate channel, made the substrate specificity of variant to short-chain esters [9,30]. Another reported salt bridge between 242 Arg and 179 Asp in the lipase from Geobacillus thermocatenulatus caused the lid structure to be fixed in the active center, resulting in specificity toward shorter-chain substrates [23]. However, introduction of a salt bridge between the Asp33 and Arg49 in Carboxylesterase R.34 causes a distortion of the enzyme structure, making the catalytic site more accessible to larger substrates [3].…”

Halotolerant aminopeptidase M29 from Mesorhizobium SEMIA 3007 with biotechnological potential and its impact on biofilm synthesis

“…Preparation of plasmids, DNA manipulations, and transformation of E. coli BL21(DE3) competent cells were performed as previously described 67 , 68 using the following synthetic oligonucleotides: Forward 5′ CAGG CATATG ATCATGACCACACATTCG 3′ and Reverse 5′ CGAA CTCGAG CCCTCAGGCCCACT 3′ that had sites for the restriction enzymes NdeI and XhoI, respectively (underlined). The protein concentration was determined using spectrophotometer analysis with a Nanodrop ND-1000 with the theoretical extinction coefficient (54680 M −1 cm −1 ) obtained from the ProtParam tool and the Bradford method 69 with bovine serum albumin (BSA) as a reference.…”

From Data Mining of Chitinophaga sp. Genome to Enzyme Discovery of a Hyperthermophilic Metallocarboxypeptidase

“…The cloning of chtcp gene (GenBank accession number gene: BK014293) into an pHAT2 expression vector [52] was performed following the protocols described in Pereira et al, 2015 and Maester et al, 2016 [11,12], and by using the forward and reverse primers CBXF1f TATATCCATGGCAGGAAGCAAATCTACAGCAG and CBXF2r TATATAAGCTTATCCCCGGAGGAACTTGCCTGC, respectively.…”

“…Among the enzymes which have been discovered with this approach are endoglucanases, laccases, nitrilases, reductases and xylanases [9]. This is in addition to other enzymes of major industrial value such as peptidases [10], lipases [11,12] and ßglucosidases [13]. This approach shows great potential for enzyme discovery from microorganisms.…”