Characterization of diacylglycerol acyltransferase 2 from Idesia polycarpa and function analysis

Fan, Ruishen; Cai, Gui; Zhou, Xuanyuan; Qiao, Yuxin; Wang, Jiabao; Zhong, Haoming; Bo, Jiaxin; Fan, Min; Tu, Wei; Long, Feiyu; Li, Zhouqi

doi:10.1016/j.chemphyslip.2020.105023

Cited by 8 publications

(4 citation statements)

References 35 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The samples of wild Idesia polycarpa with high C16:0 content also had relatively high contents of C18:1n9c, C18:2n6c, and fatty acids. It has been reported that the IpDGAT2 was positively correlated with the rate of increase in lipid content at various growth periods of Idesia polycarpa (Fan et al, 2021), and the content of IpFAD2 was positively correlated with the concentration of unsaturated fatty acids at different growth stages of Idesia polycarpa. IpDGAT2 catalyzes the synthesis of lipids in plants, especially catalyzing the accumulation of mainly unsaturated fatty acids such as C18:2, C18:3, and C20:1.…”

Section: Correlation Analysismentioning

confidence: 94%

A systematic study on composition and antioxidant of 15 varieties of wild Idesia polycarpa fruits in China

Guo,

Zhang,

Chen

et al. 2023

Front. Sustain. Food Syst.

View full text Add to dashboard Cite

Idesia polycarpa is a good source of high-quality vegetable oil and can potentially alleviate pressure on the supply of edible oil. Exploring Idesia polycarpa could enrich the world’s food and oil resources and make up for the shortage of vegetable oil types and production. Here, 15 varieties of wild Idesia polycarpa from major wild Idesia polycarpa resource belts in the middle and upper reaches of the Yangtze River in China were investigated to elucidate the quality and antioxidant activity of wild Idesia polycarpa fruits to tap the potential exploitation capacity of Idesia polycarpa. In this study, wild Idesia polycarpa varieties with high oil quality and antioxidant activity were screened by the comprehensive evaluation of 42 indexes including oil content, dry basis white grain weight, fatty acids, tocopherols, total flavonoids, and minerals, as well as comparisons of free radical scavenging of 2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid (ABTS)) and 1,1-diphenyl-2-picrylhydrazyl (DPPH). The result showed the quality characteristics of 15 wild Idesia polycarpa: oil (MN:29.21/100 g), dry basis white grain weight (MN:17.32 g), total flavonoids (MN:27.27 RE/kg), total polyphenols (MN:159.63 GAE/kg), tocopherols [MN:356.10 mg/kg (α-tocopherol (MN:284.96 mg/kg), γ-tocopherol (MN:50. 20 mg/kg), β-tocopherol (MN:9.54 mg/kg), and δ-tocopherol (MN:11.40 mg/kg)], total mineral content (MN:25653.44 mg/kg), and fatty acids [MN:20.89/100 g (70.42% polyunsaturated fatty acids (MN:14.63/100 g), 20.29% saturated fatty acids (MN:4.25/100 g), and 9.29% monounsaturated fatty acids (MN:2.01/100 g)]. Correlation analysis revealed that flavonoids, C16:0, C18:1n9c, C18:2n6c, polyphenols, α-tocopherol, δ-tocopherol, and Ca were significantly correlated with DPPH and ABTS. Cluster analysis and principal component analysis classified the 15 wild samples into three clusters, with the first cluster represented by H8, H6, and H9 being the optimal sample as a woody oilseed crop, the second cluster represented by H10, H 12, and H11 being the optimal sample for functional oil development, and the rest could be selected with emphasis when conducting certain characteristic product development. The excellent lipids and rich nutritional and antioxidant properties suggest that Idesia polycarpa will be a new direction for the development of edible oil resources in the future.

show abstract

Section: Correlation Analysismentioning

confidence: 94%

A systematic study on composition and antioxidant of 15 varieties of wild Idesia polycarpa fruits in China

Guo,

Zhang,

Chen

et al. 2023

Front. Sustain. Food Syst.

View full text Add to dashboard Cite

show abstract

“…Gene primers were designed by Primer Premier 5.0 online software. The UBA80 (primer sequence (5 -3 ): F:AAGACCTACACCAAGCCGAA, R:CTCCGCACTCAGCATTAGGACA) was chosen as an internal control gene for normalization [60]. Total mRNA was reverse transcribed to cDNA using the M-MuLV First Strand cDNA Synthesis Kit (Sangon Biotech, China) according to the manufacturer's instructions, then subjected to qRT-PCR using SYBRTM Select Master Mix on an ABI 7500 real-time PCR system (Thermo Fisher Scientific, Waltham, MA, USA).…”

Section: Qrt-pcr Analysismentioning

confidence: 99%

Mutant Bisexual and Wild Male Flowers Were Compared by Integrated Proteome and Transcriptome Analyses to Provide Insight into the Sex Conversion of Idesia polycarpa Maxim

Wang,

Li,

Cai

et al. 2023

Forests

View full text Add to dashboard Cite

Idesia polycarpa is a dioecious tree; in field surveys, there are rare sex conversions in I. polycarpa individuals with bisexual flowers. To identify the molecular mechanisms underlying sex conversion in this species, an integrative analysis of the proteome and transcriptome profiles of I. polycarpa male and bisexual flowers at key developmental stages was conducted in this study using isobaric tags for relative and absolute quantification and RNA-seq technology. A total of 15,003 proteins were identified; the differentially expressed proteins (DEPs) were enriched in metabolic pathways, biosynthesis of secondary metabolites, and flavonoid metabolism pathways in all comparison groups. A total of 290,442 unigenes were obtained; these were compared with seven databases, revealing 196,366 annotated unigenes. In general, the expression of proteins and genes tended to be positively correlated, with Spearman correlation coefficients in the ranges of 0.152–0.262 (all genes and all proteins) and 0.497–0.778 (DEPs and DEGs). The integrative analysis of DEPs and DEGs between male and bisexual flowers revealed that the most significantly enriched pathways were flavonoid pathways, metabolic pathways, and the biosynthesis of secondary metabolites. Finally, four co-expressed proteins and transcripts and one gene associated with the flavonoid biosynthesis pathway were screened out. The proteins identified were p-coumaroyl shikimate 3′-hydroxylase, and shikimate/quinate hydroxycinnamoyl transferase, and the gene was caffeoyl-CoA O-methyltransferase. The analysis has revealed key potential proteins and genes involved in sex conversion at the molecular level and has provided a basis for future investigations of artificial regulation of sex differentiation in I. polycarpa.

show abstract

“…Given the important function of DGAT1 and DGAT2, researchers have attempted to utilize these genes for crop improvement and biodiesel making. Overexpression of DGAT1 and DGAT2 significantly increases the seed oil content of different plants, especially oil crops [ [3] , [4] , [5] , [6] , [7] , [8] , [9] , [10] , 12 , 13 , [20] , [21] , [22] , [23] , [24] , [25] , [26] ]. Seed-specific overexpression of an exogenous Vernonia galamensis DGAT1A gene could break the negative linkage of oil and protein contents in soybean seeds, and improve oil yield and nutritional value simultaneously [ 4 ].…”

Section: Introductionmentioning

confidence: 99%

Newly identified essential amino acids affecting peanut (Arachis hypogaea L.) DGAT2 enzyme activity

Peng

Zheng

Tian

et al. 2023

Heliyon

View full text Add to dashboard Cite

Characterization of diacylglycerol acyltransferase 2 from Idesia polycarpa and function analysis

Cited by 8 publications

References 35 publications

A systematic study on composition and antioxidant of 15 varieties of wild Idesia polycarpa fruits in China

A systematic study on composition and antioxidant of 15 varieties of wild Idesia polycarpa fruits in China

Mutant Bisexual and Wild Male Flowers Were Compared by Integrated Proteome and Transcriptome Analyses to Provide Insight into the Sex Conversion of Idesia polycarpa Maxim

Newly identified essential amino acids affecting peanut (Arachis hypogaea L.) DGAT2 enzyme activity

Contact Info

Product

Resources

About