Characterization of a <i>Listeria monocytogenes</i>‐specific protein capable of inducing delayed hypersensitivity in <i>Listeria</i>‐immune mice

Göhmannn, S.; Wächter, M. Leimeister; Schiltz, Emil; Goebel, Werner; Chakraborty, Trinad

doi:10.1111/j.1365-2958.1990.tb00683.x

Cited by 36 publications

(20 citation statements)

References 30 publications

(19 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The lmaA gene was previously shown to encode a listerial antigen capable of eliciting a delayed-type hypersensitivity reaction in Listeria-immune mice (13). These studies also indicated that the lmaA gene is a highly specific marker for pathogenic Listeria spp.…”

mentioning

confidence: 84%

“…The resulting plasmid was named pLM68.1.1 and encodes the LmaD polypeptide. For expression of lmaA, we chose the recombinant plasmid pLM10, which was described previously (13). The inserts of all constructs used in this study were verified by DNA sequencing.…”

Section: Methodsmentioning

confidence: 99%

“…A marker that also localized to this chromosomal region was the previously published lmaB and lmaA genes (13,29).…”

mentioning

confidence: 99%

See 2 more Smart Citations

Identification, cloning, and characterization of the Ima operon, whose gene products are unique to Listeria monocytogenes

Schäferkordt

Chakraborty

1997

J Bacteriol

View full text Add to dashboard Cite

The lmaA gene of Listeria monocytogenes encodes a protein capable of inducing delayed-type hypersensitivity reactions in L. monocytogenes-immune mice (S. Göhmann, M. Leimeister-Wächter, E. Schiltz, W. Goebel, and T. Chakraborty, M. Microbiol. 4:1091-1099, 1990). Here we show that it is the last gene of the lma operon, which now comprises four genes, lmaDCBA. Maxicell analysis of peptides encoded by the lma operon identified four polypeptides of 16.7, 16.4, 14.9, and 21 kDa which correspond to the gene products encoded by the lmaD, -C, -B, and -A genes, respectively. Northern blot analysis of the lma operon showed that lmaA is expressed by two transcripts: the longer lmaDCBA transcript of 2,100 nucleotides, which was observed at growth temperatures of 37 and 20؇C, and a shorter transcript consisting of lmaBA, which is detected only at low temperatures (20؇C). Two promoters, one preceding the lmaD gene and another located upstream of the lmaB gene, were detected. An extended stem-loop structure resembling box elements found in other gram-positive pathogens was also present in the lmaC-lmaB intergenic region. By immunoblot analysis, we found that although LmaA was produced at both temperatures (20 and 37؇C), it was secreted into culture supernatants only at 20؇C. However, LmaA lacks a bona fide signal peptide sequence and could, like flagellin, be secreted by a type III transport system. DNA hybridization studies indicate that the lma operon is species specific and restricted to pathogenic strains of L. monocytogenes.The gram-positive, facultative intracellular bacterium Listeria monocytogenes is a foodborne pathogen responsible for infections in immunocompromised persons and pregnant women. Listerial infections can result in meningitis, meningoencephalitis, septicemia, and death (10, 12, 16). The consumption of contaminated food has been shown to be the major route of infection. In addition to causing sporadic listeriosis, L. monocytogenes has been implicated in several epidemics in Europe and North America (2, 37). The ability of L. monocytogenes to grow at 4ЊC, a temperature at which many off-theshelf foodstuffs are stored, opens up a unique environment for listerial enrichment (16,43). Listerial products that are expressed at low growth temperatures are therefore a relevant area of study.Virulence factors necessary for entry, intracellular survival, multiplication, and motility have been previously characterized. The genes encoding these factors are organized in two clusters on the listerial chromosome. The main cluster contains the genes coding for hemolysin (hly), phospholipases (plcA, plcB), metalloprotease (mpl), and actin nucleation factor (actA) and includes the virulence regulator protein PrfA (6, 18-21, 27, 28). The internalin genes inlA and inlB, which are required for uptake of the bacteria into the eukaryotic cell, are arranged as an operon close to but separate from the other virulence locus (29). The expression of the inlA and inlB genes is regulated by both PrfA-dependent and -independent mechani...

show abstract

mentioning

confidence: 84%

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Identification, cloning, and characterization of the Ima operon, whose gene products are unique to Listeria monocytogenes

Schäferkordt

Chakraborty

1997

J Bacteriol

View full text Add to dashboard Cite

show abstract

“…The probe for lmaAB was made in the same way with oligonucleotides GATTATACACCGGGAGCTGCTAAAG (positions 415 to 439 in Gohmann et al [11]) and GCCCTCAGTAATCGT TAAATCAACAAG (positions 829 to 855 in Gohmann et al [11]). The probe for hly was a 410-bp HindIlI fragment containing the distal end of the gene (22).…”

Section: Methodsmentioning

confidence: 99%

Physical map of the Listeria monocytogenes chromosome

Michel

Cossart

1992

J Bacteriol

View full text Add to dashboard Cite

The circular physical map of the pathogenic bacterium Listeria monocytogenes LO28 (serovar 1/2c) was established by using pulsed-field gel electrophoresis. The L. monocytogenes chromosome contains eight NotI fragments of 1,100, 940, 400, 335, 280, 45, 30, and 20 kb in size and eight Sse8387I fragments of 860, 680, 680, 370, 335, 130, 70, and 25 kb. Therefore, the total length of the genome is 3,150 kb. To order the NotI fragments on the chromosome, we used a strategy which can be of general use. We first cloned chromosomal HindIII or EcoRI fragments in pBR322. DNA extracted from the total libraries was digested by NotI and ligated to a NotI-kanamycin resistance cassette obtained by cutting Tn5 with NotI. After transformation in Escherichia coli, kanamycin-resistant clones originating from NotI-containing EcoRI or HindIII fragments were isolated. The two EcoRI-NotI or HindIII-NotI fragments of each recombinant plasmid were isolated and used as probes on Southern blot hybridizations to identify and link the corresponding NotI fragments. Seven NotI fragments were ordered in this way. The last junction was demonstrated by partial digest analysis. All L. monocytogenes genes identified so far as well as the six rRNA operons were localized on the NotI map. Regions homologous to genes from closely related bacteria were also detected and localized. Southern blot analysis of simple Sse8387I digests or double Sse8387I-NotI digests probed with the various NotI probes allowed us to align the Sse8387I fragments and localize the single SfiI site, resulting in the establishment of the first genetic and physical map of the L. monocytogenes chromosome.

show abstract

“…Gohmann et al described antigens that elicit an immune response during Listeria infection (36). One of the proteins was named antigen A (lmaA), and it is encoded by ftbG.…”

Section: Discussionmentioning

confidence: 99%

F-Type Bacteriocins of Listeria monocytogenes: a New Class of Phage Tail-Like Structures Reveals Broad Parallel Coevolution between Tailed Bacteriophages and High-Molecular-Weight Bacteriocins

et al. 2016

View full text Add to dashboard Cite

Listeria monocytogenes is a significant foodborne human pathogen that can cause severe disease in certain high-risk individuals. L. monocytogenes is known to produce high-molecular-weight, phage tail-like bacteriocins, or "monocins," upon induction of the SOS system. In this work, we purified and characterized monocins and found them to be a new class of F-type bacteriocins. The L. monocytogenes monocin genetic locus was cloned and expressed in Bacillus subtilis, producing specifically targeted bactericidal particles. The receptor binding protein, which determines target cell specificity, was identified and engineered to change the bactericidal spectrum. Unlike the F-type pyocins of Pseudomonas aeruginosa, which are related to lambda-like phage tails, monocins are more closely related to TP901-1-like phage tails, structures not previously known to function as bacteriocins. Monocins therefore represent a new class of phage tail-like bacteriocins. It appears that multiple classes of phage tails and their related bacteriocins have coevolved separately in parallel. IMPORTANCEPhage tail-like bacteriocins (PTLBs) are structures widespread among the members of the bacterial kingdom that are evolutionarily related to the DNA delivery organelles of phages (tails). We identified and characterized "monocins" of Listeria monocytogenes and showed that they are related to the tail structures of TP901-1-like phages, structures not previously known to function as bacteriocins. Our results show that multiple types of envelope-penetrating machines have coevolved in parallel to function either for DNA delivery (phages) or as membrane-disrupting bacteriocins. While it has commonly been assumed that these structures were coopted from phages, we cannot rule out the opposite possibility, that ancient phages coopted complex bacteriocins from the cell, which then underwent adaptations to become efficient at translocating DNA.T wo types of high-molecular-mass (Ͼ10 6 -Da), phage tail-like bacteriocins (PTLBs), the R type and the F type, are known to exist in the bacterial kingdom (1, 2). R-type bacteriocins (RTBs) are contractile nanotube machines evolutionarily related to Myoviridae tails (e.g., that of bacteriophage T4) (3), type 6 secretion systems (4, 5), insecticidal protein injector complexes (6, 7), and structures involved in bacterium-marine animal interactions (8). RTBs are composed of a tube surrounded by a contractile sheath (9). At one end of the sheath is a complex baseplate structure to which six receptor binding proteins (RBPs) are attached. RTBs kill target bacteria by first binding to a receptor on the cell surface via RBPs. This event triggers sheath contraction, which then drives the tube structure through the cell envelope. The result is a dissipation of the membrane potential and cell death. Contact with a single RTB particle is sufficient to kill a cell (10). Far less studied are the F-type bacteriocins (FTBs). These high-molecular-weight bactericidal protein structures are evolutionarily related to the nonco...

show abstract

Characterization of a Listeria monocytogenes‐specific protein capable of inducing delayed hypersensitivity in Listeria‐immune mice

Cited by 36 publications

References 30 publications

Identification, cloning, and characterization of the Ima operon, whose gene products are unique to Listeria monocytogenes

Identification, cloning, and characterization of the Ima operon, whose gene products are unique to Listeria monocytogenes

Physical map of the Listeria monocytogenes chromosome

F-Type Bacteriocins of Listeria monocytogenes: a New Class of Phage Tail-Like Structures Reveals Broad Parallel Coevolution between Tailed Bacteriophages and High-Molecular-Weight Bacteriocins

Contact Info

Product

Resources

About