Characterization of 132 bp Repeats BamH1-H Region in Pathogenic Marek’s Disease Virus of Poultry in Gujarat, India, Using PCR and Sequencing

Abstract

A total of 34 clinical samples and four Marek's disease virus (MDV) vaccines were tested using primer BamH1/BamH2 in layer birds of poultry. Out of 34 samples tested for detection of MDV, 32 samples produced approximately 434 bp product. All the three HVT vaccines as well as SB-1 (MDV-2) vaccine failed to produce the expected amplicons, there by proving negative for the targeted 132 bp repeats of MDV genome by the primers BamH1/BamH2. Resultant PCR products of the field samples were purified and sequenced and resulted in 378 bp long sequences. PCR was found very satisfactory in detecting the presence of MDV either in feather follicle or in tissue samples. Sequencing study has proved beyond doubt that the two representative samples contained two 132 bp repeats indicating the virulent nature of the field virus.

Characterization of Marek’s disease virus and phylogenetic analyses of meq gene from an outbreak in poultry in Meghalaya of Northeast India

“…Our result showed the presence of MDV-1 in Meghalaya. Amplification of 318 bp ICP4 gene was in agreement with [10] who reported similar finding from field samples indicating the MDV-1. The presence of REV in the samples was also investigated but could not amplify any target genes.…”

“…Molecular detection of MDV was done by detection of ICP4 gene with the primers sequences-forward 5 0 -GGAT CGCCCACCACGATTACTACC-3 0 and reverse 5 0 -ACTG CCTCACACAACCTCATCTCC-3 0 [10] and Meq gene primer, forward-5 0 -ATGTCTCAGGAGCCAGAGCCGG CGCT-3 0 and reverse-5 0 -GGGGCATAGACGATGTGCT GCTGAG-3 0 [11]. The DNA from the tissue was extracted using QIAamp viral DNA kit (Qiagen, GmbH, Hilden, Germany) and used for detection of MDV.…”

Molecular detection and phylogenetic analysis of avian reticuloendotheliosis virus from formalin fixed tissue by PCR in fancy chicken

“…GAGATCCTCGTAAGGTGTAATATA 25 µL volume of 12.5 µL of master mix (2x), 1 µL of forward and reverse primer each (10 pmol/ µL), 7.5 µL of deionized water and 3 µL of extracted DNA. PCR program was carried out as previously described for REV (Garcia et al, 2003), MD (Kalyani et al, 2011) and ALV (Smith et al, 1998). The analysis of PCR product was carried out in 1.5 per cent agarose gel stained with ethidium bromide (0.5µg/ml) and documented under Gel documentation system.…”

Isolation and identification of Marek’s disease virus (MDV) from feather follicle epithelium and internal organs of diseased chickens in Dakahlia Governorate, Egypt

“…Four sample [follicle epithelium (1), ovary (1), spleen(1), kidney(1)] were selected to confirm MDV diagnosis using PCR . Oligonucleotide primers were designed according to Kalyani et al, (2010) for amplification of ICP4 gene of MDV. Oligonucleotide primers used in the PCR reaction were synthesized by sigma chemical company, USA.…”