Characterization and stabilization of the α-L-fucosidase set from Lacticaseibacillus rhamnosus INIA P603

Curiel, José Antonio; Peirotén, Ángela; Langa, Susana; Vega, Estela; Blasco, Laura Marcos; Landete, José María

doi:10.1007/s00253-022-12262-w

Cited by 3 publications

(3 citation statements)

References 20 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Hence, this is the first time where a GH3 β-glucosidase is reported to defucosylate substrates such as pNPAFU. This activity had previously been described in LABs and bifidobacteria, the latter being characterized by producing different α-L-fucosidase enzymes with different phylogenetic lineages (Curiel et al 2021 , and Curiel et al 2022 ), but unlike GluLm, none of them had been clustered within the GH3 β-glucosidase family. Despite this, the phylogenetic study of bifidobacterial fucosidases showed a great diversity, and some of them could exhibit additional glycosidase activities other than fucosidase (Curiel et al 2021 ), which could agree with the results obtained with GluLm.…”

Section: Discussionmentioning

confidence: 77%

“…The L. mucosae INIA P508 GluLm amino acid sequence (NCBI accession WP_143112948) was explored in silico to search for similar sequences, conserved domains, and phylogenetic analysis as described by Curiel et al ( 2021 ) by using BLAST (NCBI), the InterPro database (EMBL), and Jalview 2.11.1.4 software, respectively. Furthermore, gluLm was PCR-amplified using the primers gluLmF (5′- AGAAGGAGATATAACT ATG acaaaagtagacttgaattttgttgaggg ) and gluLmR (5′- GTGGTGGTGATGGTGATGGCC atctagttcattttaatttttgcagcaactc ) and subsequently cloned into pLATE31 following the ligation-independent cloning (LIC) procedure described by Curiel et al ( 2022 ).…”

Section: Methodsmentioning

confidence: 99%

“…Furthermore, GluLm was also assayed using fucosylated oligosaccharides 2′-fucosyllactose and 3-fucosyllactose as natural substrates. The released fucose was monitored using the K-Fucose kit (Megazyme) as described by Curiel et al ( 2022 ). The results were performed in triplicate and are shown as means ± standard deviations.…”

Section: Methodsmentioning

confidence: 99%

See 2 more Smart Citations

Characterization and stabilization of GluLm and its application to deglycosylate dietary flavonoids and lignans

Curiel,

de la Bastida,

Langa

et al. 2024

Appl Microbiol Biotechnol

Self Cite

View full text Add to dashboard Cite

This study describes the characterization of the recombinant GH3 aryl-β-glucosidase “GluLm” from Limosilactobacillus mucosae INIA P508, followed by its immobilization on an agarose support with the aim of developing an efficient application to increase the availability and concentration of flavonoid and lignan aglycones in a vegetal beverage. In previous studies, heterologous GluLm-producing strains demonstrated a great capacity to deglycosylate flavonoids. Nevertheless, the physicochemical properties and substrate spectrum of the enzyme remained unknown up to now. A high production of purified GluLm was achieved (14 mg L−1). GluLm exhibited optimal activity at broad ranges of pH (5.0–8.0) and temperature (25–60°C), as well as high affinity (Km of 0.10 mmol L−1) and specific constant (86554.0 mmol L−1 s−1) against p-nitrophenyl-β-D-glucopyranoside. Similar to other GH3 β-glucosidases described in lactic acid bacteria, GluLm exhibited β-xylosidase, β-galactosidase, and β-fucosidase activities. However, this study has revealed for the first time that a GH3 β-glucosidase is capable to hydrolyze different families of glycosylated phenolics such as flavonoids and secoiridoids. Although it exhibited low thermal stability, immobilization of GluLm improved its thermostability and allowed the development of a beverage based on soybeans and flaxseed extract with high concentration of bioactive isoflavone (daidzein, genistein), lignan (secoisolariciresinol, pinoresinol, and matairesinol), and other flavonoid aglycones. Key points • Limosilactobacillus mucosae INIA P508 GluLm was purified and biochemically characterized • Immobilized GluLm efficiently deglycosylated flavonoids and lignans from a vegetal beverage • A viable application to produce vegetal beverages with a high content of aglycones is described

show abstract

Section: Discussionmentioning

confidence: 77%

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Characterization and stabilization of GluLm and its application to deglycosylate dietary flavonoids and lignans

Curiel,

de la Bastida,

Langa

et al. 2024

Appl Microbiol Biotechnol

Self Cite

View full text Add to dashboard Cite

show abstract

Production of recombinant glycosidases fused with Usp45 and SpaX to avoid the purification and immobilization stages

Curiel,

de Vega,

Langa

et al. 2024

Enzyme and Microbial Technology

View full text Add to dashboard Cite

Linking human milk oligosaccharide metabolism and early life gut microbiota: bifidobacteria and beyond

Lordan,

Roche,

Delsing

et al. 2024

Microbiol Mol Biol Rev

View full text Add to dashboard Cite

SUMMARY Human milk oligosaccharides (HMOs) are complex, multi-functional glycans present in human breast milk. They represent an intricate mix of heterogeneous structures which reach the infant intestine in an intact form as they resist gastrointestinal digestion. Therefore, they confer a multitude of benefits, directly and/or indirectly, to the developing neonate. Certain bifidobacterial species, being among the earliest gut colonizers of breast-fed infants, have an adapted functional capacity to metabolize various HMO structures. This ability is typically observed in infant-associated bifidobacteria, as opposed to bifidobacteria associated with a mature microbiota. In recent years, information has been gleaned regarding how these infant-associated bifidobacteria as well as certain other taxa are able to assimilate HMOs, including the mechanistic strategies enabling their acquisition and consumption. Additionally, complex metabolic interactions occur between microbes facilitated by HMOs, including the utilization of breakdown products released from HMO degradation. Interest in HMO-mediated changes in microbial composition and function has been the focal point of numerous studies, in recent times fueled by the availability of individual biosynthetic HMOs, some of which are now commonly included in infant formula. In this review, we outline the main HMO assimilatory and catabolic strategies employed by infant-associated bifidobacteria, discuss other taxa that exhibit breast milk glycan degradation capacity, and cover HMO-supported cross-feeding interactions and related metabolites that have been described thus far.

show abstract

Characterization and stabilization of the α-L-fucosidase set from Lacticaseibacillus rhamnosus INIA P603

Cited by 3 publications

References 20 publications

Characterization and stabilization of GluLm and its application to deglycosylate dietary flavonoids and lignans

Characterization and stabilization of GluLm and its application to deglycosylate dietary flavonoids and lignans

Production of recombinant glycosidases fused with Usp45 and SpaX to avoid the purification and immobilization stages

Linking human milk oligosaccharide metabolism and early life gut microbiota: bifidobacteria and beyond

Contact Info

Product

Resources

About