Characteristics of the Life Cycle of Porcine Deltacoronavirus (PDCoV) In Vitro: Replication Kinetics, Cellular Ultrastructure and Virion Morphology, and Evidence of Inducing Autophagy

Abstract

Porcine deltacoronavirus (PDCoV) causes severe diarrhea and vomiting in affected piglets. The aim of this study was to establish the basic, in vitro characteristics of the life cycle such as replication kinetics, cellular ultrastructure, virion morphology, and induction of autophagy of PDCoV. Time-course analysis of viral subgenomic and genomic RNA loads and infectious titers indicated that one replication cycle of PDCoV takes 5 to 6 h. Electron microscopy showed that PDCoV infection induced the membrane rearrangements with double-membrane vesicles and large virion-containing vacuoles. The convoluted membranes structures described in alpha- and beta-coronavirus were not observed. PDCoV infection also increased the number of autophagosome-like vesicles in the cytoplasm of cells, and the autophagy response was detected by LC3 I/II and p62 Western blot analysis. For the first time, this study presents the picture of the PDCoV infection cycle, which is crucial to help elucidate the molecular mechanism of deltacoronavirus replication.

Porcine deltacoronavirus (PDCoV) modulates calcium influx to favor viral replication

“…Previous studies suggested that PDCoV infection induces apoptosis in swine testicular and LLC-PK1 cells, possibly through the activation of the cytochrome c-mediated intrinsic mitochondrial pathway (Jung et al, 2016;Lee and Lee, 2018). A recent study also showed that PDCoV infection induces autophagosome-like vesicles associated with increased autophagic activity (Qin et al, 2019). In addition, vomiting is a common clinical symptom of PDCoV-infected piglets (Zhang, 2016).…”

Trypsin promotes porcine deltacoronavirus mediating cell-to-cell fusion in a cell type-dependent manner

“…The PDCoV S gene was cloned into pCAGGS-HA by the following primers with EcoR I and Xho I (F: CTGAATTCCTCGAGATGCAGAGAGCTC, R: AACTCGAGCTACCATTCCTTAAACTTAAAGG). PDCoV Chinese "Hunan" strain was used as in our previous described study [30]. PDCoV was isolated and prepared in LLC-PK cells (less than 15 passages) in the presence of 5 μg/ml trypsin and without foetal bovine serum.…”

Characterization of a novel bat-HKU2-like swine enteric alphacoronavirus (SeACoV) infection in cultured cells and development of a SeACoV infectious clone

“…1B-E). The single-cycle growth of SeACoV in Vero cells is hence similar to those of mouse hepatitis virus (MHV), SARS-CoV and PDCoV, taking approximately 4-6 h (Prentice et al, 2004;Qin et al, 2019). These data collectively demonstrated that rSeACoV and its parental virus share the same virological features.…”

“…A number of studies on ultrastructural characterization of CoV-infected cells in vitro have demonstrated the presence of altered membrane architectures such as the double-membrane vesicles (DMVs), the large virion-containing vacuoles (LVCVs) and the phagosome-like vacuoles during CoV replication and morphogenesis (Goldsmith et al, 2004;Gosert et al, 2002;Qin et al, 2019;Salanueva et al, 1999;V'Kovski et al, 2015). DMVs are membrane structures where viral genomic RNA is recognized by the host cell machinery and translated into non-structural proteins (ORF1ab), assembling into viral replication-transcription complexes (Gosert et al, 2002), whereas LVCVs are large circular organelles that are thought to originate from Golgi compartments expanding to accommodate numerous precursor virions Ulasli et al, 2010).…”