Characterisation and confirmation of rare beta-thalassaemia mutations in the Malay, Chinese and Indian ethnic groups in Malaysia

Tan, Ji; Chin, Pui See; Wong, Yean Ching; Tan, Kong Wai; Chan, Lee Lee; George, Elizabeth

doi:10.1080/00313020600922538

Cited by 18 publications

(10 citation statements)

References 22 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Intermarriages between the Malays and the indigenous populations in Sarawak are common, as observed in our patients with Malay-Kedayan, Malay-Bisayah or Malay-Bugis parentage. Results from this study showed an unexpected observation of homozygosity for the Filipino β-deletion in the Malays, as previous studies had shown that the Filipino β-deletion is rare in the Malays [17]. The Filipino β-deletion was reported to be highly prevalent in the Kadazandusuns in Sabah at 12.8% in the general population [11], and in this study, the Filipino β-deletion was also the most common defect causing β-thalassemia in the Kedayan, Bisayah and Tagal patients.…”

Section: Discussionsupporting

confidence: 52%

See 1 more Smart Citation

Transfusion-Dependent Thalassemia in Northern Sarawak: A Molecular Study to Identify Different Genotypes in the Multi-Ethnic Groups and the Importance of Genomic Sequencing in Unstudied Populations

Tan

Chin²,

Ong

et al. 2014

Public Health Genomics

Self Cite

View full text Add to dashboard Cite

Background: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Methods: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Results: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α^3.7/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. Conclusion: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.

show abstract

Section: Discussionsupporting

confidence: 52%

“…Results from this study show that the Chinese patients in Northern Sarawak have identical β-globin gene mutations (CD41/42, CD17, CD71/72, IVS2-654 and -29) to those of the Chinese in West Malaysia [17]. The Malaysian Chinese are emigrants from Southern China.…”

Section: Discussionmentioning

confidence: 99%

Transfusion-Dependent Thalassemia in Northern Sarawak: A Molecular Study to Identify Different Genotypes in the Multi-Ethnic Groups and the Importance of Genomic Sequencing in Unstudied Populations

Tan

Chin²,

Ong

et al. 2014

Public Health Genomics

Self Cite

View full text Add to dashboard Cite

show abstract

“…Beta-thalassemia major produces severe anemia that requires life-long blood transfusions for survival. The molecular defects producing β -thalassemia are heterogeneous, and each ethnic group possesses its own specific set of mutations [3, 4]. Alpha-thalassemia has also been reported and the fatal condition, Hb Bart's hydrops fetalis, is present mainly in the Malaysian Chinese.…”

Section: Introductionmentioning

confidence: 99%

High Prevalence of Alpha- and Beta-Thalassemia in the Kadazandusuns in East Malaysia: Challenges in Providing Effective Health Care for an Indigenous Group

Tan

Lee

Wee

et al. 2010

Journal of Biomedicine and Biotechnology

Self Cite

View full text Add to dashboard Cite

Thalassemia can lead to severe transfusion-dependent anemia, and it is the most common genetic disorder in Malaysia. This paper aims to determine the prevalence of thalassemia in the Kadazandusuns, the largest indigenous group in Sabah, East Malaysia. α- and β-thalassemia were confirmed in 33.6% and 12.8%, of the individuals studied respectively. The high prevalence of α- and β-thalassemia in the Kadazandusuns indicates that thalassemia screening, genetic counseling, and prenatal diagnosis should be included as part of their healthcare system. This preliminary paper serves as a baseline for further investigations into the health and genetic defects of the major indigenous population in Sabah, East Malaysia.

show abstract

“…Only one other patient from Malaysia has been reported since the original report with a compound heterozygote mutation of c.4G>A (GTG>ATG) and IVS1-1 (G→A) [5,6]. Although the combination of Hb South Florida with β-thalassemia was found in the Malay with no associated clinical symptoms except hematological results consistent with the beta thalassemia trait, we knew that the interactions between 2 different Hb variants could result in more severe disease.…”

Section: To the Editormentioning

confidence: 99%

First Observation of Hb South Florida [beta 1(NA1) Val>Met] in Turkey

Aslanger¹,

Akbulut²,

Tokgöz³

et al. 2013

Tjh

View full text Add to dashboard Cite

Characterisation and confirmation of rare beta-thalassaemia mutations in the Malay, Chinese and Indian ethnic groups in Malaysia

Cited by 18 publications

References 22 publications

Transfusion-Dependent Thalassemia in Northern Sarawak: A Molecular Study to Identify Different Genotypes in the Multi-Ethnic Groups and the Importance of Genomic Sequencing in Unstudied Populations

Transfusion-Dependent Thalassemia in Northern Sarawak: A Molecular Study to Identify Different Genotypes in the Multi-Ethnic Groups and the Importance of Genomic Sequencing in Unstudied Populations

High Prevalence of Alpha- and Beta-Thalassemia in the Kadazandusuns in East Malaysia: Challenges in Providing Effective Health Care for an Indigenous Group

First Observation of Hb South Florida [beta 1(NA1) Val>Met] in Turkey

Contact Info

Product

Resources

About