Changes in the rumen microbiome and metabolites reveal the effect of host genetics on hybrid crosses

Li, Zhipeng; Wright, André‐Denis G.; Si, Huazhe; Wang, Xiaoxu; Qian, Wei; Zhang, Zhigang; Li, Guangyu

doi:10.1111/1758-2229.12482

Cited by 38 publications

(47 citation statements)

References 47 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…This discrepancy in the fungal populations observed are inevitable as feeds and breeds of experimental animals affect population dynamics. It should be noted though, that the primers used in the current study have been used in the previous study [24] and in one of our previous studies [25], where sheep, cattle and deer were examined. This primer pair has successfully generated amplicons from all samples collected from the current study and was therefore being adopted.…”

Section: Discussionmentioning

confidence: 99%

“…For analyzing rumen fungal profile, primers MN100F (TCCTACCCTTTGTGAATTTG) and MNGM2 (CTGCGTTCTTCATCGTTGCG) targeting internal transcribed spacer region of anaerobic fungi [24] and the PCR amplification were performed according to the conditions described by previous study [25]. After quality control and purification, the qualified PCR products with bright main strip were chosen for sequencing on an Illumina HiSeq2500 platform to generate 250 bp paired-end reads.…”

Section: Amplification Sequencing and Statistical Analysismentioning

confidence: 99%

See 1 more Smart Citation

Characterization of Anaerobic Rumen Fungal Community Composition in Yak, Tibetan Sheep and Small Tail Han Sheep Grazing on the Qinghai-Tibetan Plateau

Guo

Wang

et al. 2020

Animals

View full text Add to dashboard Cite

The anaerobic rumen fungal community play a critical role in fibrous material degradation. However, there is a lack of data describing the composition of anaerobic rumen fungal community of full grazing ruminants in the Qinghai-Tibetan Plateau. For this reason, we employed the next-generation sequencing technique to elucidate the rumen fungal structure composition and evaluate the effects of host species on fungal communities. Community comparisons (Bray–Curtis index) between yak and Tibetan sheep revealed that the rumen fungal community was affected by host species (p < 0.05). The alpha diversity indices in the yak were significantly higher than in the Tibetan sheep and Small Tail Han sheep. Neocallimastigomycota was predominant regardless of host species. Within this phylum, unidentified genus of Neocallimastigaceae was the most dominant in all samples, followed by Piromyces and Orpinomyces. Moreover, the shared and unique OTUs in the rumen were identified and most of them belonged to the Orpinomyces. Co-occurrence network analysis identified that each animal species had their own keystone species and most of them were non-dominant flora. Our data indicate that host breeds override living environment as the key factor that determines fungal community in the rumen of grazing ruminants in the Qinghai-Tibetan Plateau.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Amplification Sequencing and Statistical Analysismentioning

confidence: 99%

Characterization of Anaerobic Rumen Fungal Community Composition in Yak, Tibetan Sheep and Small Tail Han Sheep Grazing on the Qinghai-Tibetan Plateau

Guo

Wang

et al. 2020

Animals

View full text Add to dashboard Cite

show abstract

“…This stresses the fact that even the most extreme perturbation of the microbiome could not change the rumen microbial composition in a stable manner and suggests a high host specificity of the rumen microbiome composition once established. Moreover, recent studies show a connection between the individual animals' genetics and its respective microbiome, as well as heritability of some rumen microbiome components (Roehe et al, 2016;Li et al, 2016;Sasson et al, 2017). These factors might hinder successful inoculation of previously isolated microbial strains.…”

Section: Potential Modulation Of the Rumen Microbiomementioning

confidence: 99%

Review: The compositional variation of the rumen microbiome and its effect on host performance and methane emission

Mizrahi

Jami

2018

Animal

View full text Add to dashboard Cite

The rumen microbiome has the important task of supplying ruminants with most of their dietary requirements and is responsible for up to 90% of their metabolic needs. This tremendous feat is possible due to the large diversity of microorganisms in the rumen. The rumen is considered one of the most diverse ecosystems on the planet in terms of species diversity and functional richness. From the moment the feed is ingested, it enters a vast cascade in which specialized microorganisms degrade specific components of the feed turning them into molecules, which in turn are utilized as anabolic precursors and energy sources for the animal. The output of this degradation process not only affects the animal, but also has an extensive impact on the environment. Some of the byproducts that are emitted as waste from this process, such as methane, act as greenhouse gases which greatly contribute to global warming. Recent technological advances developed to study this community enabled a larger overview of its vast taxonomic and functional diversity, thus leading to a better understanding of its ecology and function. This deeper understanding of the forces affecting the microbiome includes the forces that shape composition, the variation among animals, the stability of its key components, the processes of succession on a short- and long-time scales such as primary colonization and diurnal oscillations. These collective understandings have helped to provide insights into the potential effects that these forces have on the outputs observed from the animal itself. Over the recent years, there has been a growing body of evidence demonstrating the link between the microbiome and its effect on productivity of the host animals and the environment, which has placed rumen microbiome studies in the forefront of animal agricultural research. In this review, we focus on the natural variations in community composition, which are not the results of different management or feed but rather intrinsic features of animals. We characterize the rumen microbiome, its potential impact on its host as well as the barriers in implementing the current knowledge to modulate the microbiome and point toward potential avenues to overcome these hurdles.

show abstract

“…It has been hypothesized that this is due to the increased time available for the dietary material to be acted upon by enzymes and the gut microbiota [8]. However, it is also possible that different host species select for/harbor different gut microbial communities, as has been previously shown in a study with two species of deer and a hybrid derived from them [11].…”

Section: Introductionmentioning

confidence: 95%

Domesticated equine species and their derived hybrids differ in their fecal microbiota

Edwards

Schennink

Burden³

et al. 2020

anim microbiome

View full text Add to dashboard Cite

Background: Compared to horses and ponies, donkeys have increased degradation of dietary fiber. The longer total mean retention time of feed in the donkey gut has been proposed to be the basis of this, because of the increased time available for feed to be acted upon by enzymes and the gut microbiota. However, differences in terms of microbial concentrations and/or community composition in the hindgut may also underpin the increased degradation of fiber in donkeys. Therefore, a study was conducted to assess if differences existed between the fecal microbiota of pony, donkey and hybrids derived from them (i.e. pony × donkey) when fed the same forage diet. Results: Fecal community composition of prokaryotes and anaerobic fungi significantly differed between equine types. The relative abundance of two bacterial genera was significantly higher in donkey compared to both pony and pony x donkey: Lachnoclostridium 10 and 'probable genus 10' from the Lachnospiraceae family. The relative abundance of Piromyces was significantly lower in donkey compared to pony × donkey, with pony not significantly differing from either of the other equine types. In contrast, the uncultivated genus SK3 was only found in donkey (4 of the 8 animals). The number of anaerobic fungal OTUs was also significantly higher in donkey than in the other two equine types, with no significant differences found between pony and pony × donkey. Equine types did not significantly differ with respect to prokaryotic alpha diversity, fecal dry matter content or fecal concentrations of bacteria, archaea and anaerobic fungi. Conclusions: Donkey fecal microbiota differed from that of both pony and pony × donkey. These differences related to a higher relative abundance and diversity of taxa with known, or speculated, roles in plant material degradation. These findings are consistent with the previously reported increased fiber degradation in donkeys compared to ponies, and suggest that the hindgut microbiota plays a role. This offers novel opportunities for pony and pony × donkey to extract more energy from dietary fiber via microbial mediated strategies. This could potentially decrease the need for energy dense feeds which are a risk factor for gut-mediated disease.

show abstract

Changes in the rumen microbiome and metabolites reveal the effect of host genetics on hybrid crosses

Cited by 38 publications

References 47 publications

Characterization of Anaerobic Rumen Fungal Community Composition in Yak, Tibetan Sheep and Small Tail Han Sheep Grazing on the Qinghai-Tibetan Plateau

Characterization of Anaerobic Rumen Fungal Community Composition in Yak, Tibetan Sheep and Small Tail Han Sheep Grazing on the Qinghai-Tibetan Plateau

Review: The compositional variation of the rumen microbiome and its effect on host performance and methane emission

Domesticated equine species and their derived hybrids differ in their fecal microbiota

Contact Info

Product

Resources

About