Changes in Expression of Contractile FP and Relaxatory EP2 Receptors in Pregnant Rat Myometrium during Late Gestation, at Labor, and Postpartum1

Abstract

Prostaglandins synthesized at parturition may act via specific myometrial receptors as mediators of uterine contractions. Several isoforms of eicosanoid (prostaglandin) receptors, identified by pharmacological means, are linked to contractile (FP, EP1, EP3) or relaxatory (EP2, EP4, IP, DP) intracellular pathways. Changes in mRNA expression of the contractile FP and the relaxatory EP2 receptor were measured in myometrium throughout gestation, at parturition, and postpartum. Timed pregnant rats were killed at 0900 h on Day 16, 18, 20, 21, 21.5, or 22 (parturition) of pregnancy or one day postpartum (n = 5 animals/group). A longitudinal section of myometrium was removed, total RNA was extracted, and semiquantitative reverse transcription-polymerase chain reaction (RT-PCR) was performed for glyceraldehyde phosphate dehydrogenase (GAPDH), calponin, EP2, and FP receptor mRNA expression. Complementary DNA products were run on agarose gels and visualized, and the quantity of cDNA product was measured against a DNA mass ladder. RT-PCR product identity was confirmed by restriction enzyme cleavage. EP2 receptor mRNA expression was highest at Day 16 and declined significantly to Day 21.5 and one day postpartum (p < 0.05, Student-Newman-Keuls procedure). Expression of FP receptor mRNA was low at Day 16 of gestation and increased significantly until delivery (p < 0.05, ANOVA) at Day 22, then fell to prepartum levels at one day postpartum. Myometrial activity at parturition may change from an active quiescent to an active contractile state in concert with a decline in expression of the relaxatory EP2 receptors and up-regulation of contractile FP receptors.

Smoothelin-like 1 Protein Is a Bifunctional Regulator of the Progesterone Receptor during Pregnancy

“…PR is expressed in target cells as two distinct isoforms, PR-A and PR-B, generated from a single gene through the use of two alternative promoters (19,20). In USM, although the precise molecular mechanisms are unknown, PR is thought to promote relaxation by specifically inhibiting expression of the oxytocin receptor and prostaglandin F receptor, targeted by the contractile agonists oxytocin and PGF2␣ (21)(22)(23)(24)(25). In the case of PGF2␣, PR is also involved in inhibiting the expression of key enzymes involved in the metabolism of PGF2␣, such as cyclooxygense-2 and 15-hydroxy-PGdehydrogenase (26 -29).…”

Specific Amelogenin Gene Splice Products Have Signaling Effects on Cells in Culture and in Implants in Vivo

“…The products obtained initially were reamplified by PCR using the same primers. by extension at 72°C for 10 min; product, 292 bp; (ii) for Cbfa1 (34) forward, CCGCACGACAACCGCACCAT (nt 511-530); reverse, CGCTCCGGCCCACAAATCTC (nt 781-800), denaturation 3 min at 94°C, followed by 30 cycles: 30 s at 94°C, 30 s at 60°C, 50 s at 72°C, followed by extension at 72°C for 10 min; product, 289 bp; (iii) for collagen II (rat type II, GenBank TM accession number L48440) forward, CACACCGGT AAGTGGGGCAAGACC (nt 4258 -4281), reverse, CT-GCGGTTAGAAAGTATTTGGGTC (nt 4444 -4468), denaturation 3 min at 94°C, followed by 30 cycles: 30 s at 94°C, 30 s at 65°C; 50 s at 72°C, followed by extension for 10 min at 72°C; product, 210 bp; (iv) for collagen I (rat type I, pro ␣2(I), GenBank TM accession number AF121217), forward, GCTCAGCTTTGTGGATACGCG (nt 3-24), reverse, GTCAGAATACTGAGCAGCAAA (nt 243-267), denaturation 3 min at 94°C, followed by 30 cycles: 30 s 94°C, 30 s at 58°C, 50 s at 72°C, followed by extension for 10 min at 72°C; product, 264 bp; and (v) for glyceraldehyde-phosphate dehydrogenase (43,44), forward, CT-TCACCACCATGGAGAAGG (nt 276 -293), reverse, CTTACTCCTTG-GAGGCCAT (nt 944 -963), denaturation 3 min at 94°C, followed by 30 cycles: 30 s 94°C, 30 s at 58°C, 50 s at 72°C, followed by extension for 10 min at 72°C; product, 687 bp. All PCR products were run on ethidium bromide-containing 3% agarose gels at 75 volts for 60 min.…”

Hormones and Calcium: Mechanisms Controlling Uterine Smooth Muscle Contractile Activity

“…While there are species-specific differences in relative importance and timing, in general, the components of the signalling pathways favouring contraction and parturition are enhanced in myometrium late in pregnancy or in labour (Challis & Lye, 1994;Fuchs, 1995;Challis et al 1999). FP receptor RNA in pregnant human myometrium is low relative to non-pregnant myometrium (Matsumoto et al 1997) but increases in a number of species in labour (Brodt-Eppley & Myatt, 1998Ma et al 1999). FP receptor mRNA is increased in pregnancy and labour (Dong & Yallampalli, 2000).…”