Cell‐cycle‐regulated transcription of A‐ and B‐type plant cyclin genes in synchronous cultures

Abstract

SummarySynchronously dividing cell cultures of Catharanthus roseus were used to isolate cDNAs for two mitotic cyclins, named CYS and CYM. The deduced protein sequence of CYS is similar to that of A-type cyclins, and CYM belongs to the group of B-type cyclins. In a fashion similar to the pattern of expression seen for A-type and B-type cyclins in mammalian cells, CYS is expressed before CYM in C. roseus cells during the cell cycle. CYS mRNA accumulated at the onset of S phase and disappeared early in the G2 phase, whereas CYM mRNA was detected in the G2 and M phases of the cell cycle. Tobacco homologs of the two genes showed similar cell-cycle dependent expression patterns in synchronous cultures of tobacco BY2 cells. In both systems, CYS was expressed much earlier in the cell cycle than most other plant A-type cyclins, and hence CYS along with the soybean cyclGm can be classified into a distinct subclass. The activities of CYMand CYS promoters during the cell cycle were analyzed in stably transformed tobacco BY2 cells. Cyclin promoter sequences of 0.5 kb could confer the typical cell-cycle-dependent expression to the ~-glucuronidase (GUS) reporter gene: the CYS Received 15 July 1996; revised 20 December 1996; accepted 17 January 1997. *For correspondence (fax +81 3 3814 1728; e-mail masakito@uts2.s.u-tokyo.ac.jp). tPresent address: Laboratoire de Biologie Generale, CNRS Universite Louis Pasteur, 12 Rue de I'Universite, 67000 Strasbourg, France. tPresent address: Botanical Gardens, Faculty of Science, University of Tokyo, Hakusan, Tokyo, 112 Japan.promoter directed S-phase-specific expression, whereas the CYM promoter drove M-phase-specific expression. These results indicate the important role of transcriptional regulation in the oscillations of cyclin mRNA levels during the cell cycle.

Mitotic Cyclins Stimulate the Activity of c-Myb-like Factors for Transactivation of G2/M Phase-specific Genes in Tobacco

“…The CDK activity for NtmybA2 seemed to be associated with specific classes of cyclins, because CycA1, CycA2, and CycB1, but not CycA3 and CycD3, were able to activate NtmybA2 in cotransfection experiments. The genes for cyclins with the potential for activation of NtmybA2 are expressed late in the cell cycle: CycA2 at G 2 and CycA1 and CycB1 at G 2 /M (20,24,38). Thus, the timing of the expression of these cyclins is consistent with the timing in the cell cycle of the CDK activity for NtmybA2, suggesting that CDK activity for NtmybA2 might be associated with these cyclins.…”

“…Our data suggest that cyclin-induced activation of NtmybA2 requires many putative sites of phosphorylation and that each site makes a contribution to the cyclininduced activation. At least two regions of NtmybA2 are important for cyclin-mediated regulation; one is located in the conserved domain that includes motifs 6 -10, and the other, including motifs [11][12][13][14][15][16][17][18][19][20], is located at the carboxyl terminus.…”

“…Thus, the timing of the expression of these cyclins is consistent with the timing in the cell cycle of the CDK activity for NtmybA2, suggesting that CDK activity for NtmybA2 might be associated with these cyclins. The genes for cyclins CycD3 and CycA3, which were inactive in the activation of NtmybA2, are expressed constitutively 2 and S-phasespecifically (20), respectively.…”

“…Plant Material and Synchronization of Cells-Maintenance and synchronization of tobacco (Nicotiana tabacum) BY2 cells were performed as described previously (20,21). In brief, BY2 cells were synchronized by treatment with aphidicolin (5 mg/liter; Wako, Osaka, Japan) for 24 h and subsequent washing with fresh medium to release the aphidicolin block.…”

“…cDNA fragments encoding A1-, A3-, B1-, and D3-type cyclins from tobacco were amplified by PCR from plasmids that included cDNA for Ntcyc25 (24), NtCYS (20), NtCYM (20), and NtcycD1 (25), respectively. PCR was conducted with the following pairs of sense primers, each of which included a BamHI site, and antisense primers, each of which included NotI site: ACGGATCCATGGCGACGACCCAGAAT and ATG-CGGCCGCTTAGCAGCTTATGTTCTGGA for Ntcyc25; ACGGATCCA-TGGCGAACGAAGAAAATAAG and ATGCGGCCGCTCAAGCATCAT-CAAAAAAACAAG for NtCYS; ACGGATCCATGGCTTCAAGAAACG-TTCT and ATGCGGCCGCTATTCATATGAAGAAGCAGC for NtCYM; and ACGGATCCATGGGAATACAACACAATGAG and ATGCGGCCG-CGAGGGCTGCCAACAG for NtcycD1.…”