CEL I Enzymatic Mutation Detection Assay

Kulinski, Joanne; Besack, David; Oleykowski, Catherine A.; Godwin, Andrew K.; Yeung, Anthony T.

doi:10.2144/00291bm07

Cited by 60 publications

(38 citation statements)

References 3 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…For loci Pis_GEN_27, Pis_GEN_28, and psat_EST_00176 the annealing temperature was reduced to 51°. The resulting markers were resolved by size difference on agarose gel electrophoresis by the MS-PCR method (Rust et al 1993), the CEL I endonuclease approach (Kulinski et al 2000), and/or by the tagged microarray (TAM) approach (Flavell et al 2003;Jing et al 2007). In the latter case e and g tags were appended to X and Y tags (supplemental Table 3), respectively, by inclusion of TAM tag primers e-X (ACCGCATCCGAACA TTTGTC½spacer C-18CGTGCCGCAAGGACGGGC) and g-Y (GCCGATAATCACCTTGTCAC½spacer C-18TATATTATGGG CCGCACTGACGGAC), and the e and g tags were detected by the TAM approach.…”

Section: Methodsmentioning

confidence: 99%

“…Markers were scored in either or both recombinant inbred line (RIL) mapping populations JI15 3 JI399 and JI281 3 JI399 (Ellis et al 1992). Loci Psat_EST_172, Psat_EST_185, Psat_EST_189, Psat_EST_191, Pis_GEN_15, and Pis_GEN_27 were scored by the CEL 1 approach (Kulinski et al 2000) in an attenuated RIL population of 16 and positioned by matching scores to existing data in an Excel spread sheet.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Gene-Based Sequence Diversity Analysis of Field Pea (Pisum)

et al. 2007

View full text Add to dashboard Cite

Sequence diversity of 39 dispersed gene loci was analyzed in 48 diverse individuals representative of the genus Pisum. The different genes show large variation in diversity parameters, suggesting widely differing levels of selection and a high overall diversity level for the species. The data set yields a genetic diversity tree whose deep branches, involving wild samples, are preserved in a tree derived from a polymorphic retrotransposon insertions in an identical sample set. Thus, gene regions and intergenic ''junk DNA'' share a consistent picture for the genomic diversity of Pisum, despite low linkage disequilibrium in wild and landrace germplasm, which might be expected to allow independent evolution of these very different DNA classes. Additional lines of evidence indicate that recombination has shuffled gene haplotypes efficiently within Pisum, despite its high level of inbreeding and widespread geographic distribution. Trees derived from individual gene loci show marked differences from each other, and genetic distance values between sample pairs show high standard deviations. Sequence mosaic analysis of aligned sequences identifies nine loci showing evidence for intragenic recombination. Lastly, phylogenetic network analysis confirms the non-treelike structure of Pisum diversity and indicates the major germplasm classes involved. Overall, these data emphasize the artificiality of simple tree structures for representing genomic sequence variation within Pisum and emphasize the need for fine structure haplotype analysis to accurately define the genetic structure of the species.T HE genetic diversity of a species is the sum of its total DNA sequence variation, resulting from millions of years of cumulative mutation, recombination, and selection. Understanding the pattern of the diversity within cultivated plant species and their wild relatives is both interesting and practically important from the viewpoint of conservation and use. Therefore, the ways by which genetic diversity in populations are estimated and represented are important. A popular approach for measuring the genetic diversity of accessions of a species is to analyze samples from gene banks (germplasm collections) by one or more of the many available molecular marker methods. The effectiveness of this strategy depends upon the suitability of the marker method for analyzing the diversity of the sample collection under investigation. Different marker methods can give different views of diversity, depending upon the evolutionary parameters of the underlying DNA sequence variation. Rapidly evolving DNAs, such as simple sequence repeats (SSRs), give high resolution views of relatedness; single nucleotide polymorphism (SNP)-based variation is more suited to deeper relationships, reflecting the slow mutation rate for this type of sequence variation; and transposon insertion-based marker methods should lie between these two, reflecting their intermediate mutation rate, although few studies have been carried out to test this. Furthermore, the g...

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Gene-Based Sequence Diversity Analysis of Field Pea (Pisum)

et al. 2007

View full text Add to dashboard Cite

show abstract

“…the S1 protocol is suitable only for insertions/ deletions larger than three nucleotides because it cannot detect single-base substitutions (17). Such substitutions can be solved by direct sequencing or using other sss endonucleases, such as cel i (7,9,18) and Surveyor nuclease (13,16).…”

Section: Resultsmentioning

confidence: 99%

An Improved Site-Directed Mutagenesis Procedure and Application for Identification of Mutant Clones

Sun

Chen

et al. 2012

Biotechnology & Biotechnological Equipment

View full text Add to dashboard Cite

show abstract

“…CEL 1 is isolated from celery and has a high specificity for insertions, deletions and basesubstitution mismatches (Kulinski et al, 2000;Oleykowski et al, 1998). Fragments up to 2 kb can be screened with a high throughput.…”

Section: Single-nucleotide Aberrations As Prognostic Markers In Breasmentioning

confidence: 99%

Methods and biomarkers for the diagnosis and prognosis of cancer and other diseases: Towards personalized medicine

Anderson

Hansen

Mooren

et al. 2006

Drug Resistance Updates

View full text Add to dashboard Cite

The rapid development of new diagnostic procedures, the mapping of the human genome, progress in mapping genetic polymorphisms, and recent advances in nucleic acid-and protein chip technologies are driving the development of personalized therapies. This breakthrough in medicine is expected to be achieved largely due to the implementation of "lab-on-the-chip" technology capable of performing hundreds, even thousands of biochemical, cellular and genetic tests on a single sample of blood or other body fluid. Focusing on a few disease-specific examples, this review discusses selected technologies and their combinations likely to be incorporated in the "lab-on-the-chip" and to provide rapid and versatile information about specific diseases entities. Focusing on breast cancer and after an overview of single-nucleotide polymorphism (SNP)-screening methodologies, we discuss the diagnostic and prognostic importance of SNPs. Next, using Duchenne muscular dystrophy (DMD) as an example, we provide a brief overview of powerful and innovative integration of traditional immuno-histochemistry techniques with advanced biophysical methods such as NMR-spectroscopy or Fourier-transformed infrared (FT-IR) spectroscopy. A brief overview of the challenges and opportunities provided by protein and aptamer microarrays follows. We conclude by highlighting novel and promising biochemical markers for the development of personalized treatment of cancer and other diseases: serum cytochrome c, cytokeratin-18 and -19 and their proteolytic fragments for the detection and quantitation of malignant tumor mass, tumor cell turn-over, inflammatory processes during hepatitis and Epstein-Barr virus (EBV)-induced hemophagocytic lymphohistiocytosis and apoptotic/necrotic cancer cell death.

show abstract

CEL I Enzymatic Mutation Detection Assay

Cited by 60 publications

References 3 publications

Gene-Based Sequence Diversity Analysis of Field Pea (Pisum)

Gene-Based Sequence Diversity Analysis of Field Pea (Pisum)

An Improved Site-Directed Mutagenesis Procedure and Application for Identification of Mutant Clones

Methods and biomarkers for the diagnosis and prognosis of cancer and other diseases: Towards personalized medicine

Contact Info

Product

Resources

About