cDNA cloning of human and rat brain <i>myo</i>-inositol monophosphatase. Expression and characterization of the human recombinant enzyme

McAllister, George; Whiting, Paul J.; Hammond, Emily; Knowles, Michael R.; Atack, John; Bailey, F.; Maigetter, Robert Z.; Ragan, C I

doi:10.1042/bj2840749

Cited by 102 publications

(88 citation statements)

References 26 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The K m and V max values for myo-inositol 1-phosphate were calculated as 0.071 Ϯ 0.008 mM and 12.3 Ϯ 0.4 mol/min per mg, respectively. These values are close to the reported kinetic parameters of mammalian inositol monophosphatase, that is, 0.075 Ϯ 0.003 mM (K m ) and 36.8 Ϯ 1 mol/min per mg (V max ) for the recombinant human inositol monophosphatase (22) and 0.16 Ϯ 0.02 mM (K m ) and 13.3 Ϯ 0.9 mol/min per mg (V max ) for bovine brain inositol monophosphatase (7). These data demonstrated that the SuhB protein, in these in vitro experiments, hydrolyzes the ester bond of myo-inositol 1-phosphate as effectively as mammalian enzymes do.…”

Section: Resultssupporting

confidence: 64%

“…As is the case for other inositol monophosphatases, this activity was totally dependent on Mg 2ϩ and the optimal concentration of Mg 2ϩ was 10 mM (data not shown). This value is slightly higher than the reported values of 3 mM for the bovine inositol monophosphatase (11) and of 1 mM for the human enzyme (22). At higher concentrations of Mg 2ϩ , this activity was inhibited (data not shown).…”

Section: Resultscontrasting

confidence: 52%

See 1 more Smart Citation

Inositol monophosphatase activity from the Escherichia coli suhB gene product

et al. 1995

View full text Add to dashboard Cite

The suhB gene is located at 55 min on the Escherichia coli chromosome and encodes a protein of 268 amino acids. Mutant alleles of suhB have been isolated as extragenic suppressors for the protein secretion mutation (secY24), the heat shock response mutation (rpoH15), and the DNA synthesis mutation (dnaB121) (K. Shiba, K. Ito, and T. Yura, J. Bacteriol. 160:696-701, 1984; R. Yano, H. Nagai, K. Shiba, and T. Yura, J. Bacteriol. 172:2124-2130, 1990; S. Chang, D. Ng, L. Baird, and C. Georgopoulos, J. Biol. Chem. 266:3654-3660, 1991). These mutant alleles of suhB cause cold-sensitive cell growth, indicating that the suhB gene is essential at low temperatures. Little work has been done, however, to elucidate the role of the product of suhB in a normal cell and the suppression mechanisms of the suhB mutations in the aforementioned mutants. The sequence similarity shared between the suhB gene product and mammalian inositol monophosphatase has prompted us to test the inositol monophosphatase activity of the suhB gene product. We report here that the purified SuhB protein showed inositol monophosphatase activity. The kinetic parameters of SuhB inositol monophosphatase (K m ‫؍‬ 0.071 mM; V max ‫؍‬ 12.3 mol/min per mg) are similar to those of mammalian inositol monophosphatase. The ssyA3 and suhB2 mutations, which were isolated as extragenic suppressors for secY24 and rpoH15, respectively, had a DNA insertion at the 5 proximal region of the suhB gene, and the amount of SuhB protein within mutant cells decreased. The possible role of suhB in E. coli is discussed.The suhB gene was first identified as the locus for the ssyA3(Cs) mutation that was isolated as an extragenic suppressor for the secY24(Ts) mutant (31). The ssyA3 mutation restored the defect in protein secretion caused by the secY24 mutation (33) and rescued the temperature-sensitive cell growth of secY24 mutant cells. The ssyA3 mutation caused cold-sensitive cell growth by itself and impaired protein synthesis was observed in the ssyA3 mutant at low temperatures (31). The cold-sensitive growth of the ssyA3 mutant was rescued by introduction of the wild-type copy of suhB, indicating that ssyA3 is a mutant allele of suhB (40). The suhB2(Cs) mutation is another allele of suhB and was isolated as an extragenic suppressor of the rpoH15(Ts) mutation. The rpoH15 mutant gene produces an altered 32 protein and causes a defect in the induction of heat shock proteins at higher temperatures (42). The suhB2(Cs) mutation rescued the temperature-sensitive cell growth of the rpoH15 mutant and partially restored heat shock induction in the mutant cell (40). A coldsensitive mutation was also mapped in the suhB locus as an extragenic suppressor for the dnaB121(Ts) mutation that inhibits replication of phage (2). Thus, mutant alleles of suhB have effects on diverse cell activities, including protein export, stress response, and DNA replication.The suhB gene encodes a protein of 268 amino acids (40), and the primary structure of its translated product shows a high level of similarity t...

show abstract

Section: Resultssupporting

confidence: 64%

Section: Resultscontrasting

confidence: 52%

Inositol monophosphatase activity from the Escherichia coli suhB gene product

et al. 1995

View full text Add to dashboard Cite

show abstract

“…Purification of wild-type and mutant InsPase expressed in Escheriuhia coli was carried out as described by McAllister et al (1992). The wild-type and mutant enzymes were purified to homogeneity as judged by SDS/PAGE.…”

Section: Enzyme Purificationmentioning

confidence: 99%

“…The plasmid DNA encoding the mutant Cys218+Ala (C218A) was supplied by P. Greasley and M. Gore (University of Southampton). For the construction of other mutants, oligonucleotide-directed mutagenesis was camed out by the method of Kunkel (1987) using the pRSET vector containing the gene encoding human brain InsPase (McAllister et al, 1992). The following oligonucleotides were synthesized on an Applied Biosystems 380 DNA synthesizer to introduce the corresponding mutation : S'TGGAGAACTTATCAGCATAAC3' CAGATTCATCACCAATGAA3' (E70D), S'ATCAATAGG-GTTAATGATCCA3' (DYON), S'AGTTGTTCCATTAATA-GGGTC3' (D93N), S'AAAGTTAGTTGCTCCATCAAT3' (T95A), S'CAAAGTTAGTTGATCCATCAA3' (T95S) and S'ATCCCAGCACTGAATTCCCAT3' (H217Q).…”

Section: Mutagenesismentioning

confidence: 99%

Probing the role of metal ions in the mechanism of inositol monophosphatase by site‐directed mutagenesis

Pollack

Knowles

Atack

et al. 1993

European Journal of Biochemistry

View full text Add to dashboard Cite

Since inhibition of myo-inositol monophosphatase (EC 3.1 3.25) by lithium ions and the resulting attenuation of phosphatidylinositol cycle activity may be the mechanism by which lithium exerts its therapeutic effect in the treatment of manic depression, it is of great interest to understand the mechanism of the enzyme and how lithium and other metals interact with it. Divalent magnesium is essential for enzyme activity, whereas Li' and high concentrations of Mg" act as unconipetitive inhibitors with respect to substrate. From the recently solved crystal structure of the human enzyme, several amino acid residues in the active site were targeted for mutagenesis studies. Nine singleresidue substituted mutants were characterized with regard to catalytic parameters. Mg" dependence, and Li' inhibition. In addition, a terbium fluorescence assay was developed to determine the metal binding properties of the wild-type and mutant enzymcs. Although nonc of these mutations affected K, for substrate subs~antially, the mutations Glu70+Gln, Glu70+Asp, A s p 9 0 j A s n and Thr95+Ala, in which residues within coordinating distance of the active site metal were modified, all resulted in large reductions in catalytic activity. The position of Glu70 in the crystal structure further suggests that this residue may be involved in activating water for nucleophilic attack on the substrate. The mutations Lys36+Ile, Asp90+Asn, Thr95+Ala, Thr95+Ser, His217+Gln, and Cys2 18+Ala all resulted in parallel reductions in both lithium and magnesium affinity, suggesting that Li' and Mg' ' share a common binding site.Although lithium ion has been used as a treatment for manic depression for over 40 years (Cadc, 1949). the molecular basis for its thcrapeutic effects remains uncertain. Evidence in reccnt ycars (Hallcher and Sherman, 1980: Nahorski et al., 1992; Atack ct al., 1992) has shown that Li' interferes with thc dcphosphorylation of inositol monophosphatcs in the phosphatidylinositol (PtdIns) secondary inessenger pathway (Berridge and Irvine, 1989;Berridge et al., 1989). While a direct link between lithium's cfrccts on the PtdIns cyclc and on manic depression remains to be proved, this ubiquitous intracellular cycle is linked to multiple signal transduction pathways (Berridge and Trvine, 1989; Fisher el al., 1992) and it is no1 surprising that interference with it should have profound effects.In the PtdIns cycle, receptor-activated phospholipase C hydrolyzes phosphatidylinositol 4,5-bisphosphate, to form two second messengers, diacylglycerol and inositol 1,4,5-Currvspondrnce t o S . .I. Pollack. Merck Sharp

show abstract

“…3.5, McAllister et al, 1992;pIC50 3.2, Ohnishi et al, 2007) than IMPase 2 (pIC50 1.8-2.1, Ohnishi et al, 2007). IMPase activity may be inhibited competitively by L690330 (pKi 5.5, McAllister et al, 1992), although the enzyme selectivity is not yet established. Protein serine/threonine kinases (E.C.…”

Section: Anaphylatoxinmentioning

confidence: 99%

Ligand-gated Ion Channels

Encyclopedic Reference of Molecular Pharmacology

View full text Add to dashboard Cite

cDNA cloning of human and rat brain myo-inositol monophosphatase. Expression and characterization of the human recombinant enzyme

Cited by 102 publications

References 26 publications

Inositol monophosphatase activity from the Escherichia coli suhB gene product

Inositol monophosphatase activity from the Escherichia coli suhB gene product

Probing the role of metal ions in the mechanism of inositol monophosphatase by site‐directed mutagenesis

Ligand-gated Ion Channels

Contact Info

Product

Resources

About