cDNA-AFLP analysis of gene expression changes in apple trees induced by phytoplasma infection during compatible interaction

Abstract

In order to gain insight into molecular and physiological changes in apple trees during compatible interaction with two 'Candidatus Phytoplasma mali' strains (AP and AT), cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) technique was used. A rootstock of apple (MM106) susceptible to 'Ca. P. mali' was used to extend the range of the potential host responses by the maximum number of identified genes that will be deregulated by phytoplasma in apple. Gene expression comparisons were studied in three directions: healthy versus infected samples, symptomatic versus nonsymptomatic sample, and AP-infected versus ATinfected sample. Forty-five genes whose steady-state levels of expression significantly changed in response to phytoplasma infection were identified. Among their partial cDNA sequences, only 27 showed similarity to DNA or protein data bases; of these, 18 were related to known genes in plants, and the rest were related to unknown or hypothetical proteins. Eighteen out of 45 did not show any similarity with sequences in data bases (potential novel genes). Quantitative real-time RT-PCR (qRT-PCR) was used to confirm differential expression of AFLP identified genes, and showed the similar profile expression for 11 known genes among 18, and for 13 unknown, hypothetical or novel genes among 27. Changes in gene expression involved a wide spectrum of biological functions, including processes of metabolism, cell defence, senescence, photosynthesis, transport, transcription, signal transduction and protein synthesis. This is the first study of global gene profiling in plants in response to phytoplasma infections using cDNA-AFLP, and a model is proposed to explain the mode of action of the 'Ca. P. mali' in apple.

Gene expression profiling by cDNA-AFLP reveals potential candidate genes for partial resistance of ‘Président Roulin’ against Venturia inaequalis

“…The relative expression ratio of the target genes between scab-inoculated and water-treated plants was evaluated using the ΔΔCt method described by Applied Biosystems (Relative expression ratio = 2 ΔΔCt ), with the glyceraldehyde 3-phosphate dehydrogenase gene ( GAPDH ) as the internal reference (primers sequence F-5′CAAGGTCATCCATGACAACTTTG3′, R-5′ GTCCACCACCCTGTTGCTGTAG3′). In fact, as it was the case in other qRT-PCR studies conducted on apple [ 33 , 103 ], the GAPDH gene appeared to be the best housekeeping gene in our experimental conditions. Contrary to the elongation factor gene ( EF, primers sequence F-5′TACTGGAACATCACAGGCTGAC3′, R-5′TGGACCTCTCAATCATGTTGTC3′), expression of the GAPDH was stable in scab-inoculated and water-treated leaf samples (Additional file 4 ).…”

“…For this purpose, cDNA-AFLP technology was chosen as it allowed a survey of transcriptional changes with no prior assumptions about which genes might be involved in the plant response [ 29 ]. This technique constitutes a robust solution for differential display, detecting changes in gene expression between samples, and it has been successfully applied in several quantitative expression studies in apple [ 26 , 30 – 33 ]. The genes identified in this study were annotated and sorted into Gene Ontology (GO) categories.…”

Phytoplasma-Induced Leaf Reddening as a Monitoring Symptom of Apple Proliferation Disease with Regard to the Development of Remote Sensing Strategies

“…The levels of chlorophyll a + b and carotenoids decrease, causing an inhibition of photosystem 2 [23]. Aldaghi et al [44] reported that genes associated with photosynthesis pathways were deregulated in AP-infected apple trees. Additionally, the breakdown of chlorophyll induced by AP follows the same pathways as seasonal leaf senescence [24].…”

Surveying Potential Vectors of Apple Proliferation Phytoplasma: Faunistic Analysis and Infection Status of Selected Auchenorrhyncha Species

“…'Candidatus Phytoplasma mali', the causal agent of the quarantine disease Apple proliferation (AP), is among the economical most important pathogens in European apple growing regions [13]. Infected apple trees show profound disturbance in their carbohydrate and hormone metabolism, leading to impaired fruit quality and quantity [14][15][16][17][18]. Further economic losses are caused because growers are obliged by law to eradicate infected trees.…”