CD56+, NKp46+ cell line (MZ93) expressing T-cell and myeloid antigens

Hashimoto, Shigeo; Toba, Kenji; Tsuchiyama, Junjiro; Abe, Takashi; Yano, Toshio; Momoi, Akihito; Okazuka, Kiyoshi; Kanazawa, Naoko; Takahashi, Masuhiro; Aizawa, Yoshifusa

doi:10.1016/s0145-2126(01)00115-1

Cited by 4 publications

(1 citation statement)

References 34 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…One microgram RNA was used for cDNA synthesis. Human NKp46 was amplified using the primers 5′‐CCGAATTAAACCTGTATCAAGA‐3′ and 5′‐AACTTCCCAACATCCTCCT‐3′ . cDNA synthesis and PCR amplification were performed on a TaKaRa PCR Thermal Cycler Dice Standard (TaKaRa, Kyoto, Japan) using the following thermal protocol: 50°C for 30 min and 95°C for 2 min, followed by 40 cycles of 95°C for 1 min, 60°C for 1 min, and 72°C for 1 min and a final extension step for 10 min at 72°C.…”

Section: Methodsmentioning

confidence: 99%

NKp46 regulates the production of serine proteases and IL‐22 in human mast cells in urticaria pigmentosa

Ueshima

Kataoka

Hirata

et al. 2015

Experimental Dermatology

View full text Add to dashboard Cite

NKp46 (natural cytotoxic receptor 1/CD335) is expressed on natural killer cells and Th2-type innate lymphocytes. However, NKp46 expression in human mast cells has not yet been reported. Here, we explored the expression of, and possible role played by, NKp46 in such cells. NKp46 protein was expressed in human mast cells in urticaria pigmentosa principally of the tryptase-positive/chymase-negative type (MCT), but not in human non-neoplastic skin mast cells of the tryptase-positive/chymase-positive (MCTC) type. NKp46 expression was also evident in the human neoplastic mast cell line HMC1.2. NKp46 knockdown changed the phenotype of this cell line from MCT to MCTC and downregulated GrB production, but did not influence IL-22 production. An agonistic anti-NKp46 antibody upregulated production of GrB and IL-22, but did not change the MCT-like phenotype of HMC1.2 cells. NKp46 was thus involved in the production of serine proteases and IL-22 in human mast cells.

show abstract

Section: Methodsmentioning

confidence: 99%