CCN2/CTGF regulates neovessel formation via targeting structurally conserved cystine knot motifs in multiple angiogenic regulators

Abstract

Blood vessels are formed during development and tissue repair through a plethora of modifiers that coordinate efficient vessel assembly in various cellular settings. Here we used the yeast 2-hybrid approach and demonstrated a broad affinity of connective tissue growth factor (CCN2/CTGF) to C-terminal cystine knot motifs present in key angiogenic regulators Slit3, von Willebrand factor, platelet-derived growth factor-B, and VEGF-A. Biochemical characterization and histological analysis showed close association of CCN2/CTGF with these regulators in murine angiogenesis models: normal retinal development, oxygen-induced retinopathy (OIR), and Lewis lung carcinomas. CCN2/CTGF and Slit3 proteins worked in concert to promote in vitro angiogenesis and downstream Cdc42 activation. A fragment corresponding to the first three modules of CCN2/CTGF retained this broad binding ability and gained a dominant-negative function. Intravitreal injection of this mutant caused a significant reduction in vascular obliteration and retinal neovascularization vs. saline injection in the OIR model. Knocking down CCN2/CTGF expression by short-hairpin RNA or ectopic expression of this mutant greatly decreased tumorigenesis and angiogenesis. These results provided mechanistic insight into the angiogenic action of CCN2/CTGF and demonstrated the therapeutic potential of dominant-negative CCN2/CTGF mutants for antiangiogenesis.

Connective tissue growth factor differentially binds to members of the cystine knot superfamily and potentiates platelet-derived growth factor-B signaling in rabbit corneal fibroblast cells

“…Nor were cystine knot motifs of tested growth factors because they also failed to trigger Leu2 and LacZ reporter genes when co-transformed with pB42-AD empty vector. In contrast, co-transformation with CTGF allowed survival of cells that expressed cystine knot motifs of all four growth factors on selective medium lacking leucine, supporting our previous observations that CTGF has broad binding capabilities to members of cystine knot superfamily [9] . In addition, we carried out an ONPG-based assay and assessed relative β-galactosidase activity in comparison to control cells that carried plasmids for CTGF and pLexA vector.…”

“…Previously, we used a GAL4 system and revealed CTGF's broad ability to bind with multiple cystine knot-bearing factors using His3 reporter [9] . This is a qualitative assay with potential variation dependent upon the expression levels of the fusion proteins under investigation.…”

“…Dropout supplements containing nucleotides and amino acid residues as well as additional supplements of glucose, galactose (Gal), and raffinose (Raf) were prepared according to the manufacturer's instructions. CTGF, cystine knot motifs in VEGF-A and PDGF-B were described previously [9] . The cystine knot motif of TGF-β1 was amplified using primers 5' AGGTCGACCTCCTGGCGATACCTCAGCAACGC 3' (sense) and 5' TTGCGGCCGCTGCACTTGCAGGAGCGCAC 3' (antisense) from a human cDNA clone (Genebank Accession # NM_000660.5).…”

“…These dimers represent active states of the cystine knot-bearing growth factors able to elicit signal transduction via their cognate receptors. Interestingly, many members of this superfamily including transforming growth factor (TGF)-β, bone morphogenetic protein (BMP)-4, BMP-2, vascular endothelial growth factor (VEGF)-A, PDGF-B, von Willebrand factor (vWF), the neuronal guidance cue Slit3, the growth and differentiation factor 5 (GDF5), and GDF15 are able to interact with CTGF [6][7][8][9][10][11] . It has been shown that CTGF binding can sequester VEGF-A from VEGF receptor 1 and inhibit VEGF-A stimulated angiogenesis [6] .…”

Roles of the ERK1/2 and PI3K/PKB signaling pathways in regulating the expression of extracellular matrix genes in rat pulmonary artery smooth muscle cells

“…The pathological feature of Pulmonary arterial hypertension (PAH) is pulmonary vascular remodeling (PVR) in which dysfunction of endothelial cells, neointimal formation, pulmonary arterial smooth muscle cells (PASMCs) proliferation, and the abnormal deposition of extracellular matrix (ECM) play important roles.Previous studies have found that the PASMCs can produce large amounts of ECM when stimulated by various unusual factors [1][2][3][4] . Connective tissue growth factor (CTGF) is an bioactive factor that was recently discovered to be closely associated with the abnormal deposition of ECM.…”