Cassettes for the PCR‐mediated construction of regulatable alleles in <i>Candida albicans</i>

Gerami-Nejad, Maryam; Hausauer, Danielle; McClellan, Mark; Berman, Judith; Gale, Cheryl A.

doi:10.1002/yea.1080

Cited by 51 publications

(51 citation statements)

References 23 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…As found by others, no signal was detected when YFP-Cdc42 was expressed from its own promoter . We therefore overexpressed YFP-Cdc42 by placing it under the control of the PCK1 promoter, which is induced by growth on succinate (Leuker et al, 1997), using a cassette designed for the PCRmediated construction of such alleles (Gerami-Nejad et al, 2004). Expression of the YFP-Int1, the C. albicans homolog of S. cerevisiae Bud4, was elevated eightfold when expressed from the induced PCK1 promoter compared to the native promoter (Gerami-Nejad et al, 2004).…”

Section: Resultsmentioning

confidence: 99%

“…Heterozygous fusions to green fluorescent protein (GFP), yellow fluorescent protein (YFP) and cyan fluorescent protein (CFP), and generation of promoter fusions were constructed as described previously (Gerami-Nejad et al, 2001;Gerami-Nejad et al, 2004). Candida albicans disruption strains were also constructed as described previously (Wilson et al, 1999).…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Candida albicans hyphae have a Spitzenkörper that is distinct from the polarisome found in yeast and pseudohyphae

Crampin

Finley

Gerami-Nejad

et al. 2005

Journal of Cell Science

Self Cite

175

229

View full text Add to dashboard Cite

Fungi grow with a variety of morphologies: oval yeast cells, chains of elongated cells called pseudohyphae and long, narrow, tube-like filaments called hyphae. In filamentous fungi, hyphal growth is strongly polarised to the tip and is mediated by the Spitzenkörper, which acts as a supply centre to concentrate the delivery of secretory vesicles to the tip. In the budding yeast Saccharomyces cerevisiae, polarised growth is mediated by the polarisome, a surface cap of proteins that nucleates the formation of actin cables delivering secretory vesicles to the growing tip. The human fungal pathogen, Candida albicans, can grow in all three morphological forms. Here we show the presence of a Spitzenkörper at the tip of C. albicans hyphae as a ball-like localisation of secretory vesicles, together with the formin Bni1 and Mlc1, an ortholog of an S. cerevisiae myosin regulatory light chain. In contrast, in C. albicans yeast cells, pseudohyphae and hyphae Spa2 and Bud6, orthologs of S. cerevisiae polarisome components, as well as the master morphology regulator Cdc42, localise predominantly, but not exclusively, to a surface cap resembling the polarisome of S. cerevisiae yeast cells. A small amount of Cdc42 also localises to the Spitzenkörper. Furthermore, we show differences in the genetic and cytoskeletal requirements, and cell cycle dynamics of polarity determinants in yeast, pseudohyphae and hyphae. These results, together with the cytological differences between the cell types, suggest that the Spitzenkörper and polarisome are distinct structures, that the polarisome and Spitzenkörper coexist in hyphae, and that polarised growth in hyphae is driven by a fundamentally different mechanism to that in yeast and pseudohyphae.

show abstract

Section: Resultsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Candida albicans hyphae have a Spitzenkörper that is distinct from the polarisome found in yeast and pseudohyphae

Crampin

Finley

Gerami-Nejad

et al. 2005

Journal of Cell Science

Self Cite

175

229

View full text Add to dashboard Cite

show abstract

“…BWP17 was transformed with this amplification product using the lithium acetate method; transformants were selected on synthetic defined (SD) medium [2 % glucose, 0.67 % yeast nitrogen base and 0.2 % amino acid mix with the relevant amino acids (uracil and/or leucine) left out for the appropriate experiments] lacking histidine. The conditional null strain was constructed from the heterozygote using the pMET3-GFP-URA3 construct described by Gerami-Nejad et al (2004).…”

Section: Methodsmentioning

confidence: 99%

The Candida albicans homologue of PIG-P, CaGpi19p: gene dosage and role in growth and filamentation

2010

View full text Add to dashboard Cite

Glycosylphosphatidyl inositol (GPI)-anchored proteins in Candida albicans are responsible for a vast range of functions, and deletions in certain GPI-anchored proteins severely reduce adhesion and virulence of this organism. In addition, completely modified GPIs are necessary for virulence. GPI anchor biosynthesis is essential for viability and starts with the transfer of N-acetylglucosamine to phosphatidylinositol. This step is catalysed by a multi-subunit complex, GPI–N-acetylglucosaminyltransferase (GPI–GnT). In this, the first report to our knowledge on a subunit of the Candida GPI–GnT complex, we show that CaGpi19p is the functional equivalent of the Saccharomyces cerevisiae Gpi19p. An N-terminal truncation mutant of CaGpi19p functionally complements a conditionally lethal S. cerevisiae gpi19 mutant. Further, we constructed a conditional null mutant of CaGPI19 by disrupting one allele and placing the remaining copy under the control of the MET3 promoter. Repression leads to growth defects, cell wall biogenesis aberrations, azole sensitivity and hyperfilamention. In addition, there is a noticeable gene dosage effect, with the heterozygote also displaying intermediate degrees of most phenotypes. The mutants also displayed a reduced susceptibility to the antifungal agent amphotericin B. Collectively, the results suggest that CaGPI19 is required for normal morphology and cell wall architecture.

show abstract

“…The gene for green fluorescent protein (GFP) was fused just after the ATG of RSR1 by transformation of an RSR1-specific GFP-URA3-GFP cassette into BWP17 and selection of uridine prototrophs, followed by selection, on 5-fluoroorotic acid medium (Sigma, St. Louis, MO), of transformants that had recombined the repetitive GFP sequences (and effectively lost URA3) to generate strain MG8393. Relative overexpression of GFP-Rsr1p was achieved by constructing a strain expressing GFP-RSR1 from the inducible C. albicans GAL1 promoter, using PCR-mediated gene modification as previously described (23). An RSR1-specific URA3-P GAL1 -GFP cassette was amplified using primers 1844 (5Ј-CAA TCTTCTGTCAGATTTCAATGAGAGGTATGTACATTCAACAAAAGCC CGTTACACTTGTATTTCAATAACCtctagaaggaccacctttgattg-3Ј; RSR1-specific sequence in uppercase letters) and 1845 (5Ј-CCTGGACAAATTGCACG GTGATTGAGGATTTACCTACCCCACCAGCACCCAATACTACGACTTT ATAATCTCTtttgtacaattcatccatac-3Ј) and template plasmid pURA3-PGAL1-GFP (23).…”

Section: Methodsmentioning

confidence: 99%

“…Relative overexpression of GFP-Rsr1p was achieved by constructing a strain expressing GFP-RSR1 from the inducible C. albicans GAL1 promoter, using PCR-mediated gene modification as previously described (23). An RSR1-specific URA3-P GAL1 -GFP cassette was amplified using primers 1844 (5Ј-CAA TCTTCTGTCAGATTTCAATGAGAGGTATGTACATTCAACAAAAGCC CGTTACACTTGTATTTCAATAACCtctagaaggaccacctttgattg-3Ј; RSR1-specific sequence in uppercase letters) and 1845 (5Ј-CCTGGACAAATTGCACG GTGATTGAGGATTTACCTACCCCACCAGCACCCAATACTACGACTTT ATAATCTCTtttgtacaattcatccatac-3Ј) and template plasmid pURA3-PGAL1-GFP (23). The PCR product was used for transformation into strain BWP17 to generate strain MG9232.…”

Section: Methodsmentioning

confidence: 99%

Hyphal Guidance and Invasive Growth in Candida albicans Require the Ras-Like GTPase Rsr1p and Its GTPase-Activating Protein Bud2p

Hausauer¹,

Gerami-Nejad

Kistler-Anderson

et al. 2005

Eukaryot Cell

Self Cite

View full text Add to dashboard Cite

Candida albicans, the most prevalent fungal pathogen of humans, causes superficial mycoses, invasive mucosal infections, and disseminated systemic disease. Many studies have shown an intriguing association between C. albicans morphogenesis and the pathogenesis process. For example, hyphal cells have been observed to penetrate host epithelial cells at sites of wounds and between cell junctions. Ras-and Rho-type GTPases regulate many morphogenetic processes in eukaryotes, including polarity establishment, cell proliferation, and directed growth in response to extracellular stimuli. We found that the C. albicans Ras-like GTPase Rsr1p and its predicted GTPase-activating protein Bud2p localized to the cell cortex, at sites of incipient daughter cell growth, and provided landmarks for the positioning of daughter yeast cells and hyphal cell branches, similar to the paradigm in the model yeast Saccharomyces cerevisiae. However, in contrast to S. cerevisiae, CaRsr1p and CaBud2p were important for morphogenesis: C. albicans strains lacking Rsr1p or Bud2p had abnormal yeast and hyphal cell shapes and frequent bends and promiscuous branching along the hypha and were unable to invade agar. These defects were associated with abnormal actin patch polarization, unstable polarisome localization at hyphal tips, and mislocalized septin rings, consistent with the idea that GTP cycling of Rsr1p stabilizes the axis of polarity primarily to a single focus, thus ensuring normal cell shape and a focused direction of polarized growth. We conclude that the Rsr1p GTPase functions as a polarity landmark for hyphal guidance and may be an important mediator of extracellular signals during processes such as host invasion.Candida albicans, an important fungal pathogen, causes infections in both healthy and ill persons ranging from superficial mucosal diseases (thrush and vaginitis) to life-threatening disseminated disease involving the bloodstream (sepsis), central nervous system (meningitis), and vital organs (renal, hepatic, or brain abscess, for example). C. albicans exists in three major morphologies: ellipsoid yeast-form (YF) cells, pseudohyphal cells (chains of elongated yeast cells, separated by constrictions), and extremely elongated filamentous hyphal-form (HF) cells. YF cells are thought to be the predominant morphology found during colonization at epithelial surfaces, whereas HF cells have been associated with invasion into and through epithelial and endothelial cell layers (40). Indeed, C. albicans strains with defects in hyphal morphogenesis appear to be less virulent in animal and tissue-based models of candidiasis (9,36,45,48), leading to the idea that morphogenesis is required for virulence. On the one hand, this conclusion is complicated by the realization that many of these avirulent strains lack proteins (for example, transcription factors) that likely affect not only cell shape but also many other cellular processes. Thus, it remains unclear if cell shape per se is important for the pathogenesis process or if morphology is s...

show abstract

Cassettes for the PCR‐mediated construction of regulatable alleles in Candida albicans

Cited by 51 publications

References 23 publications

Candida albicans hyphae have a Spitzenkörper that is distinct from the polarisome found in yeast and pseudohyphae

Candida albicans hyphae have a Spitzenkörper that is distinct from the polarisome found in yeast and pseudohyphae

The Candida albicans homologue of PIG-P, CaGpi19p: gene dosage and role in growth and filamentation

Hyphal Guidance and Invasive Growth in Candida albicans Require the Ras-Like GTPase Rsr1p and Its GTPase-Activating Protein Bud2p

Contact Info

Product

Resources

About