Cas9-mediated gene disruption in tetraploidGiardia intestinalis

Abstract

CRISPR/Cas9 system is an extremely powerful technique that is extensively used for different genome modifications in various organisms including parasitic protists. Giardia intestinalis, a protozoan parasite infecting large number of people around the world each year, has been eluding the use of CRISPR/Cas9 technique so far which may be caused by its rather complicated genome containing four copies of each gene in its two nuclei. Apart from only single exception (Ebneter et al., 2016), without the use of CRISPR/Cas9 technology in its full potential, researchers in the field have not been able to establish knock-out cell lines to study the functional aspect of Giardia genes. In this work, we show the ability of in-vitro developed CRISPR/Cas9 components to successfully edit the genome of G. intestinalis. Moreover, we used self-propagating CRISPR/Cas9 system to establish full knock out cell lines for mem, cwp1 and mlf1 genes. We also show that the system function even for essential genes, as we knocked-down tom40, lowering the amount of Tom40 protein by more than 90%. Further, we tested the length of homologous arms needed for successful integration of homology recombination cassette used for genome editing. Taken together, our work introduces CRISPR/Cas9 to Giardia for routine use in the lab, further extending the catalogue of molecular tolls available for genetic manipulation of the protist and allowing researchers to study the function of Giardia genes properly for the first time.

Adaptation of the late ISC pathway in the anaerobic mitochondrial organelles of Giardia intestinalis

“…Having established the integration of Gi BolA1 within the mitosomal late ISC pathway, we next examined the role of Gi BolA1 in the formation of Fe-S clusters. To this end, using the recently established CRISPR/Cas9-mediated gene knockout approach [ 42 ] G . intestinalis cell line lacking the bolA1 gene (ΔbolA1) was generated ( Fig 3A and 3B ).…”

“…For CRISPR/Cas9-mediated knockout of grx5 gene, four multiplexed gRNAs (CTAAGGCACTTGCACTGACG, TTGGTAGGAATAGGGATCTG, AATGCCAGTGTGTGCTCCCT and GATGGATTCGCTCTGCGCCA) were inserted into 4 consecutive gRNA cassettes within the pTGuide vector [ 42 ] using two annealed oligonucleotides (see S5 Table for primers and restriction enzymes used). The 526 bp of 5´ and 608 bp 3´ homologous arms surrounding grx5 gene were inserted into pTGuide vector as the homologous arms for the recombination of the resistance cassette ( S5 Table ).…”

Disc and Actin Associated Protein 1 influences attachment in the intestinal parasite Giardia lamblia

“…Using CRISPR-interference, we depleted DAAP1 from cells, and found a mild defect in attachment, but no obvious impact on disc morphology (Figs 5 – 7 ). While a DAAP1 knockout [ 58 ] would give us better insight into how DAAP1 loss affects the disc, the ability to readily knockout genes of interest remains under development. CRISPRi and morpholino knockdown both have variable penetrance, and thus the level of depletion fluctuates among cells, and we observed normal discs even in cells with very little DAAP1 fluorescence ( Fig 5 ).…”