Cardiac Overexpression of PDE4B Blunts β-Adrenergic Response and Maladaptive Remodeling in Heart Failure

Abstract

Background: The cyclic AMP (adenosine monophosphate; cAMP)-hydrolyzing protein PDE4B (phosphodiesterase 4B) is a key negative regulator of cardiac β-adrenergic receptor stimulation. PDE4B deficiency leads to abnormal Ca 2+ handling and PDE4B is decreased in pressure overload hypertrophy, suggesting that increasing PDE4B in the heart is beneficial in heart failure. Methods: We measured PDE4B expression in human cardiac tissues and developed 2 transgenic mouse lines with cardiomyocyte-specific overexpression of PDE4B and an adeno-associated virus serotype 9 encoding PDE4B. Myocardial structure and function were evaluated by echocardiography, ECG, and in Langendorff-perfused hearts. Also, cAMP and PKA (cAMP dependent protein kinase) activity were monitored by Förster resonance energy transfer, L-type Ca 2+ current by whole-cell patch-clamp, and cardiomyocyte shortening and Ca 2+ transients with an Ionoptix system. Heart failure was induced by 2 weeks infusion of isoproterenol or transverse aortic constriction. Cardiac remodeling was evaluated by serial echocardiography, morphometric analysis, and histology. Results: PDE4B protein was decreased in human failing hearts. The first PDE4B-transgenic mouse line (TG15) had a ≈15-fold increase in cardiac cAMP-PDE activity and a ≈30% decrease in cAMP content and fractional shortening associated with a mild cardiac hypertrophy that resorbed with age. Basal ex vivo myocardial function was unchanged, but β-adrenergic receptor stimulation of cardiac inotropy, cAMP, PKA, L-type Ca 2+ current, Ca 2+ transients, and cell contraction were blunted. Endurance capacity and life expectancy were normal. Moreover, these mice were protected from systolic dysfunction, hypertrophy, lung congestion, and fibrosis induced by chronic isoproterenol treatment. In the second PDE4B-transgenic mouse line (TG50), markedly higher PDE4B overexpression, resulting in a ≈50-fold increase in cardiac cAMP-PDE activity caused a ≈50% decrease in fractional shortening, hypertrophy, dilatation, and premature death. In contrast, mice injected with adeno-associated virus serotype 9 encoding PDE4B (10 12 viral particles/mouse) had a ≈50% increase in cardiac cAMP-PDE activity, which did not modify basal cardiac function but efficiently prevented systolic dysfunction, apoptosis, and fibrosis, while attenuating hypertrophy induced by chronic isoproterenol infusion. Similarly, adeno-associated virus serotype 9 encoding PDE4B slowed contractile deterioration, attenuated hypertrophy and lung congestion, and prevented apoptosis and fibrotic remodeling in transverse aortic constriction. Conclusions: Our results indicate that a moderate increase in PDE4B is cardioprotective and suggest that cardiac gene therapy with PDE4B might constitute a new promising approach to treat heart failure.

Cardiac cAMP-PKA Signaling Compartmentalization in Myocardial Infarction

“…In addition, heart-targeting systems would support the development of new therapeutic agent classes, such as PPI disruptors (peptides, small compounds) or nucleic acids (siRNA) [268][269][270]. Alternatively, gene therapy strategies using associated adenoviruses (AAVs) exhibiting preferential cardiac tropism would specifically direct expression of cAMP modulators/regulators (e.g., PDE, AC), peptides (e.g., PKI, PPI disruptors) or siRNA in the heart and could be considered as therapeutic options [259,271].…”

Identification of Key Pathways and Genes in Polycystic Ovary Syndrome via Integrated Bioinformatics Analysis and Prediction of Small Therapeutic Molecules

“…The GO and pathway enrichment analysis was of great importance for interpreting the molecular mechanisms of the key cellular activities in PCOS. RPS5 [37], RBM3 [38], BAK1 [39], NDUFC2 [40], NDUFS4 [41], NDUFS5 [42], UQCRFS1 [43], COX6B1 [44], NDUFA13 [45], PRMT1 [46], RDX (radixin) [47], EPHB4 [48], SYNE2 [49], DNAH5 [50], NEDD4L [51], PDE4B [52] and CTNND1 [53] plays a critical role in the process of cardiovascular disease, but these genes might be linked with development of PCOS. Ostergaard et al [54], Zi et al [55], Kunej et al [56], Van der Schueren et al [57], Jin et al [58], Emdad et al [59], Liu et al [60], Scherag et al [61], Shi and Long [62], Sharma et al [63], Parente et al [64], Saint-Laurent et al [65] and Lee [66] demonstrated that over expression of COA3, PHB (prohibitin), UQCRC1, COX4I1, IFI27, MTDH (metadherin), S100A16, SDCCAG8, GLI2, NTN1, NLGN2, FGFR3 and PTPRN2 could cause obesity, but these genes might be involved in progression of PCOS.…”

GPR39 promotes cardiac hypertrophy by regulating the AMPK–mTOR pathway and protein synthesis

“…For the knockdown of GPR39 in the hearts of mice, an adeno‐associated virus 9 (AAV9) system was applied. AAV9‐mediated shRNA targeting control construct (AAV9‐shCtrl, 5′‐TTCTCCGAACGTGTCACGT‐3′) or GPR39 (AAV9‐shGPR39, 5′‐GCTCCACACGTTCCTCTTTGA‐3′) were generated as described previously (Ding et al, 2015; Karam et al, 2020). Briefly, to generate p. AAV.U6‐shRNA constructs, DNA fragments harboring U6 promoter‐driven shCtrl or shGPR39 cassettes were separately cloned into the ITR‐containing AAV9 plasmid.…”

“…AAV9 was packaged in HEK293T cells with AAV9:Rep‐Cap and pHelper (pAd deltaF6), and the virus was purified and concentrated by gradient centrifugation. One‐week‐old male C57BL/6 mice received a single intravenous injection of saline or AAV9 vector via the jugular vein at a concentration of ≈1 × 10 11 viral genomes per mouse, as previously described (Ding et al, 2015; Karam et al, 2020).…”