Carbohydrate metabolism in the subtending leaf cross‐acclimates to waterlogging and elevated temperature stress and influences boll biomass in cotton (Gossypium hirsutum)

Abstract

Short-term waterlogging and chronic elevated temperature occur concomitantly in the cotton (Gossypium hirsutum) growing season. While previous research about co-occurring waterlogging and elevated temperature has focused primarily on cotton fiber, no studies have investigated carbohydrate metabolism of the subtending leaf (a major source leaf for boll development) cross-acclimation to aforementioned stressors. To address this, plants were exposed to ambient (31.6/26.5°C) and elevated (34.1/29.0°C) temperatures during the whole flowering and boll formation stage, and waterlogging (0, 3, 6 days) beginning on the day of anthesis. Both waterlogging and high temperature limited boll biomass (reduced by 1.19-32.14%), but effects of different durations of waterlogging coupled with elevated temperature on carbohydrate metabolism in the subtending leaf were quite different. The 6-day waterlogging combined with elevated temperature had the most negative impact on net photosynthetic rate (Pn) and carbohydrate metabolism of any treatment, leading to upregulated GhSusA and GhSusC expression and enhanced sucrose synthase (SuSy, EC 2.4.1.13) activity for sucrose degradation. A prior exposure to waterlogging for 3 days improved subtending leaf performance under elevated temperature. Pn, sucrose concentrations, Rubisco (EC 4.1.1.39) activity, and cytosolic fructose-1,6-bisphosphatase (cy-FBPase, EC 3.1.3.11) activity in the subtending leaf significantly increased, while SuSy activity decreased under 3 days waterlogging and elevated temperature combined relative to elevated temperature alone. Thus, we concluded that previous exposure to a brief (3 days) waterlogging stress improved sucrose composition and accumulation cross-acclimation to high temperature later in development not only by promoting leaf photosynthesis but also inhibiting sucrose degradation.

Elevated temperature and waterlogging decrease cottonseed quality by altering the accumulation and distribution of carbohydrates, oil and protein

“…In our study, under the combination of waterlogging and ET stresses, significant decreases in seed weight, kernel weight and shell weight per boll were observed (Table 1). Previous studies have indicated that increased temperature combined with waterlogging at the flowering and boll‐forming stages slowed the outward translocation of sucrose from the subtending leaf and altered boll biomass accumulation characteristics, limiting cotton boll biomass (Wang et al 2017). The decrease in seed biomass was accompanied by a decrease in carbohydrate content when the plants were subjected to waterlogging or ET alone or the combined stresses (Table 2), which was in agreement with the finding of a previous study on rapeseed (Xu et al 2015).…”

Analysis of the regulation networks in grapevine reveals response to waterlogging stress and candidate gene-marker selection for damage severity

“…The most notable examples are the upregulation of genes involved in glycolysis and fermentation, and the downregulation of genes involved in sucrose and starch metabolism, citrate cycle, mitochondrial electron transport and photosynthesis (figures 9 b and 5 ; electronic supplementary material, table S5). The comparisons of early transcriptomes of Arabidopsis , maize and cotton responses to waterlogging found that hypoxia triggers the overexpression of TPS in all three species [ 55 – 57 ]. TPS catalyses the first step of trehalose synthesis, which is important in plant response to abiotic stresses [ 58 ].…”

Influence of drought stress on pistil physiology and reproductive success of twoGossypium hirsutumcultivars differing in drought tolerance

“…A cDNA synthesis kit (TaKaRa, Japan) was used for the synthesis of first‐strand cDNA. Primers of genes were from previous papers in our laboratory (Chen et al , Wang et al ): 18S , 5′‐TGACG GAGAATTAGGGTTCGA‐3′ and 5′‐CCGTGTCAGGATTGGGTAATTT‐3′; GhSUT‐1 , 5′‐CTAGGCCAATGTGGATGTTG‐3′ and 5′‐CTTTGCC CATCCAGTCAGTA‐3′. The gene 18S was the housekeeping gene.…”