Cannabinoid receptor expression and phosphorylation are differentially regulated between male and female cerebellum and brain stem after repeated stress: Implication for PTSD and drug abuse

Xing, Guoqiang; Carlton, Janis; Zhang, Lei; Jiang, Xiaolong; Fullerton, Carol S.; Li, He; Ursano, Robert J.

doi:10.1016/j.neulet.2011.05.013

Cited by 30 publications

(16 citation statements)

References 49 publications

(52 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The higher base-line CB 1 mRNA expression in the adolescent female rat brain when compared to their male counterparts is consistent with the reports of greater CB 1 mRNA expression in the white blood cells of female humans (64, 65), higher eCBs content in the brains of female rats (66) and increased CB 1 mRNA expression in the cerebella and brainstems of female rats (34). Because, CB 1 activity is neuroprotective and a lack of CB 1 activity in CB 1 knockout animals is linked with increased mortality (67), our findings support the notion that greater base-line CB 1 expression in female adolescent brains may underlie the reduced mortality in pubescent compared to the females with moderate-to-severe TBI when compared with adolescent males of the same TBI severity (6).…”

Section: Discussionsupporting

confidence: 89%

“…CB1 (TTTCCCACTCATTGACGAGAC, GTGAGCCTTCCAGAGAATGT) and CB2 (AAAGCACACCAACATGTAGCC, GGAACCAGCATATGAGCAGAA) qPCR primers were designed using Primer3 software (MIT, MA, USA) with the size of amplified cDNA ranging between 90 and 150 bp (34). Quantification of CB 1 and CB 2 mRNA expression was performed (in triplicate) using a two-step PCR reaction procedure on an iQ5 Real-Time PCR System (BioRad, CA, USA) using the SYBR Green SuperMix (BioRad, CA, USA).…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Differential Expression of Brain Cannabinoid Receptors between Repeatedly Stressed Males and Females may Play a Role in Age and Gender-Related Difference in Traumatic Brain Injury: Implications from Animal Studies

et al. 2014

Self Cite

View full text Add to dashboard Cite

Inconsistent gender differences in the outcome ofTBI have been reported.The mechanism is unknown. In a recent male animal study, repeated stress followed by TBI had synergistic effects on brain gene expression and caused greater behavioral deficits. Because females are more likely to develop anxiety after stress and because anxiety is mediated by cannabinoid receptors (CBRs) (CB 1 and CB 2 ), there is a need to compare CB 1 and CB 2 expression in stressed males and females. CB 1 and CB 2 mRNA expression was determined in the amygdala, hippocampus, prefrontal cortex (PFC), and hypothalamus of adolescent male and female rats after 3 days of repeated tail-shock stress using qPCR. PFC CB 1 and CB 2 protein levels were determined using Western blot techniques. Both gender and stress had significant effects on brain CB 1 mRNA expression levels. Overall, females showed significantly higher CB 1 and CB 2 mRNA levels in all brain regions than males (p < 0.01). Repeated stress reduced CB 1 mRNA levels in the amygdala, hippocampus, and PFC (p < 0.01, each). A gender × stress interaction was found in CB 1 mRNA level in the hippocampus (p < 0.05), hypothalamus (p < 0.01), and PFC (p < 0.01). Within-sex one-way ANOVA analysis showed decreased CB 1 mRNA in the hippocampus, hypothalamus, and PFC of stressed females (p < 0.01, each) but increased CB 1 mRNA levels in the hypothalamus of stressed males (p < 01).There was a gender and stress interaction in prefrontal CB 1 receptor protein levels (p < 0.05), which were decreased in stressed females only (p < 0.05). Prefrontal CB 2 protein levels were decreased in both male and female animals after repeated stress (p < 0.05, each). High basal levels of CBR expression in young naïve females could protect against TBI damage whereas stress-induced CBR deficits could predict a poor outcome of TBI in repeatedly stressed females. Further animal studies could help evaluate this possibility.

show abstract

Section: Discussionsupporting

confidence: 89%

Section: Methodsmentioning

confidence: 99%

Differential Expression of Brain Cannabinoid Receptors between Repeatedly Stressed Males and Females may Play a Role in Age and Gender-Related Difference in Traumatic Brain Injury: Implications from Animal Studies

et al. 2014

Self Cite

View full text Add to dashboard Cite

show abstract

“…CB1-R mRNA transcript levels have been reported to be higher in anterior pituitary [34] and lower in cerebellum [35], prefrontal cortex, amygdala, and hippocampus [36] in males, compared to females. Greater CB1-R density has been observed in male animals in mesencephalon [37], hypothalamus [38], hippocampus [38, 39], and prefrontal cortex [40], compared to females, with mixed results in amygdala [38, 40], though other evidence suggests greater widespread CB1-R density in females, compared to males [41].…”

Section: Sex Differences In the Endocannabinoid Systemmentioning

confidence: 99%

Mechanisms Underlying Sex Differences in Cannabis Use

et al. 2017

View full text Add to dashboard Cite

Purpose of the Review Cannabis is the most commonly used illicit substance worldwide. In recent decades, highly concentrated products have flooded the market, and prevalence rates have increased. Gender differences exist in cannabis use, as men have higher prevalence of both cannabis use and cannabis use disorder (CUD), while women progress more rapidly from first use to CUD. This paper reviews findings from preclinical and human studies examining the sex-specific neurobiological underpinnings of cannabis use and CUD, and associations with psychiatric symptoms. Recent Findings Sex differences exist in the endocannabinoid system, in cannabis exposure effects on brain structure and function, and in the co-occurrence of cannabis use with symptoms of anxiety, depression and schizophrenia. In female cannabis users, anxiety symptoms correlate with larger amygdala volume and social anxiety disorder symptoms correlate with CUD symptoms. Female cannabis users are reported to be especially vulnerable to earlier onset of schizophrenia, and mixed trends emerge in the correlation of depressive symptoms with cannabis exposure in females and males. Summary As prevalence of cannabis use may continue to increase given the shifting policy landscape regarding marijuana laws, understanding the neurobiological mechanisms of cannabis exposure in females and males is key. Examining these mechanisms may help inform future research on sex-specific pharmacological and behavioral interventions for women and men with high-risk cannabis use, comorbid psychiatric disease, and CUD.

show abstract

“…Sex differences in behavioral responses to cocaine have been attributed to differences in the PKA and the DARPP-32 cascade in rat nucleus accumbens [57, 58]. Sex differences in phosphorylation of cannabinoid receptors that could lead to differential receptor trafficking have been demonstrated and implicated in sex differences in stress sensitivity [59]. In peripheral tissue, aortic contraction mediated by serotonin 2A receptors is greater in males compared to females as a result of increased RhoA and Rho-kinase activity, in the absence of increased expression [60].…”

Section: Sex Biased Signaling Of Other Receptorsmentioning

confidence: 99%

Sex-specific cell signaling: the corticotropin-releasing factor receptor model

Valentino

Bockstaele

Bangasser

2013

Trends in Pharmacological Sciences

View full text Add to dashboard Cite

Elucidating the biological basis for sex differences in diseases can reveal their pathophysiology and guide the development of individualized treatments. Here we review evidence for the novel concept that receptor signaling can be sex biased such that the specific pathways engaged by ligand binding are determined by sex. As an example, this review focuses on the receptor for corticotropin-releasing factor (CRF), a stress-related peptide implicated in diverse psychiatric and medical disorders that are more prevalent in females. There is evidence for sex biases in CRF receptor coupling to G-proteins and β-arrestin that render females more sensitive to acute stress and less able to adapt to chronic stress. Taken with evidence for sex biased signaling in other receptor systems, the studies demonstrate the broad potential impact of this characteristic in determining sex differences in disease and therapeutic efficacy and underscore the importance of studying females in medical and pharmacological research.

show abstract

Cannabinoid receptor expression and phosphorylation are differentially regulated between male and female cerebellum and brain stem after repeated stress: Implication for PTSD and drug abuse

Abstract: Robert, "Cannabinoid receptor expression and phosphorylation are differentially regulated between male and female cerebellum and brain stem after repeated stress: Implication for PTSD and drug abuse" (2011).

Cited by 30 publications

References 49 publications

Differential Expression of Brain Cannabinoid Receptors between Repeatedly Stressed Males and Females may Play a Role in Age and Gender-Related Difference in Traumatic Brain Injury: Implications from Animal Studies

Differential Expression of Brain Cannabinoid Receptors between Repeatedly Stressed Males and Females may Play a Role in Age and Gender-Related Difference in Traumatic Brain Injury: Implications from Animal Studies

Mechanisms Underlying Sex Differences in Cannabis Use

Sex-specific cell signaling: the corticotropin-releasing factor receptor model

Contact Info

Product

Resources

About