Cannabinoid CB1 receptor-mediated inhibition of noradrenaline release in the human and guinea-pig hippocampus Naunyn-Schmiedeberg’s Arch Pharmacol (1997) 356:583–589

Schlicker, Eberhard; Timm, Johanna; Zentner, Josef; Göthert, M.

doi:10.1007/pl00005155

Cited by 12 publications

(8 citation statements)

References 0 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…WIN 55,212-2 inhib- ited acetylcholine release by about 50%. The latter result and previous studies performed with the same superfusion equipment (with CB 1 receptor-mediated inhibitory effects of up to 80%; Schlicker et al 1996;Schlicker et al 1997) argue against the possibility that the weak inhibition of serotonin release is related to excessive binding of lipophilic drugs like WIN 55,212-2, CP-55,940 and SR 141716 to the superfusion chambers and the tubing of the superfusion apparatus. Although there are still other explanations for the weakness of effect which have to be considered (e.g.…”

Section: Discussionmentioning

confidence: 38%

“…Final proof that CB 1 receptors are involved comes from the experiments in which a rightward shift of the concentrationresponse curve of WIN 55,212-2 by the CB 1 receptor antagonist SR 141716 was shown, yielding an apparent pA 2 value not markedly different from that obtained for other functional CB 1 receptor models (e.g. Coutts and Pertwee 1997;Croci et al 1998;Schlicker et al 1996;Schlicker et al 1997).…”

Section: Discussionmentioning

confidence: 98%

“…These G protein-coupled receptors, which have been cloned (Matsuda et al 1990), occur at high densities in the CNS and at much lower densities in the periphery; they are positively coupled to some types of voltage-dependent K + channels and to mitogen-activated protein kinase and negatively to adenylyl cyclase and some types of voltage-dependent Ca 2+ channels (for review see Pertwee 1997;Childers and Breivogel 1998;Ameri 1999). Activation of CB 1 receptors inhibits the release of noradrenaline in the human and guinea-pig brain in vitro (Schlicker et al 1997;Kathmann et al 1999) and of acetylcholine in the rat brain in vitro (Gifford and Ashby 1996) and in vivo (Gessa et al 1997). CB 1 receptor-mediated inhibition of GABA release in the rat brain in vitro is suggested by an electrophysiological study (Szabo et al 1998) and was measured directly in superfusion experiments (Katona et al 1999).…”

Section: Introductionmentioning

confidence: 97%

See 2 more Smart Citations

Inhibition of serotonin release in the mouse brain via presynaptic cannabinoid CB1 receptors

Nakazi

Bauer

Nickel

et al. 2000

Naunyn-Schmiedeberg's Arch Pharmacol

Self Cite

170

View full text Add to dashboard Cite

We studied whether serotonin release in the CNS is inhibited via cannabinoid receptors. In mouse brain cortex slices preincubated with [3H]serotonin and superfused with medium containing indalpine and metitepine, tritium overflow was evoked either electrically (3 Hz) or by introduction of Ca2+ (1.3 mM) into Ca2+-free K+-rich (25 mM) medium containing tetrodotoxin. The effects of cannabinoid receptor ligands on the electrically evoked tritium overflow from mouse brain cortex slices preincubated with [3H]choline and on the binding of [3H]WIN 55,212-2 and [35S]GTPgammaS to mouse brain cortex membranes were examined as well. In superfused mouse cortex membranes preincubated with [3H]serotonin, the electrically evoked tritium overflow was inhibited by the cannabinoid receptor agonist WIN 55,212-2 (maximum effect of 20%, obtained at 1 microM; pEC50=7.11) and this effect was counteracted by the CB1 receptor antagonist SR 141716 (apparent pA2=8.02), which did not affect the evoked tritium overflow by itself. The effect of WIN 55,212-2 was not shared by its enantiomer WIN 55,212-3 but was mimicked by another cannabinoid receptor agonist, CP-55,940. WIN 55,212-2 also inhibited the Ca2+-evoked tritium overflow and this effect was antagonized by SR 141716. Concentrations of histamine, prostaglandin E2 and neuropeptide Y, causing the maximum effect at their respective receptors, inhibited the electrically evoked tritium overflow by 33, 69 and 73%, respectively. WIN 55,212-2 (1 microM) inhibited the electrically evoked tritium overflow from mouse brain cortex slices preincubated with [3H]choline by 49%. [3H]WIN 55,212-2 binding to mouse cortex membranes was inhibited by CP-55,940, SR 141716 and WIN 55,212-2 (pKi=9.30, 8.70 and 8.19, respectively) but not by the auxiliary drugs indalpine, metitepine and tetrodotoxin (pKi<4.5). [35S]GTPgammaS binding was increased by WIN 55,212-2 (maximum effect of 80%, pEC50=6.94) but not affected by WIN 55,212-3. In conclusion, serotonin release in the mouse brain cortex is inhibited via CB1 receptors, which may be located presynaptically and are not activated by endogenous cannabinoids. The extent of inhibition is smaller than that obtained (1) via another three presynaptic receptors on serotoninergic neurones and (2) via CB1 receptors on cholinergic neurones in the same tissue.

show abstract

Section: Discussionmentioning

confidence: 38%

Section: Discussionmentioning

confidence: 98%

Section: Introductionmentioning

confidence: 97%

See 1 more Smart Citation

Inhibition of serotonin release in the mouse brain via presynaptic cannabinoid CB1 receptors

Nakazi

Bauer

Nickel

et al. 2000

Naunyn-Schmiedeberg's Arch Pharmacol

Self Cite

170

View full text Add to dashboard Cite

show abstract

“…The noradrenergic supply to the hippocampal formation originates in the locus coeruleus, and recent findings have demonstrated that cannabinoids inhibit noradrenaline release in the human and guinea-pig hippocampus (30). Noradrenaline has been implicated in the process of memory retention and acquisition as well as in learning.…”

Section: Discussionmentioning

confidence: 99%

The effects of acute treatment with Δ9-THC on exploratory behaviour and memory in the rat

Hernández-Tristán

Arévalo

Canals

et al. 2000

J. Physiol. Biochem.

View full text Add to dashboard Cite

The aim of the present study was to evaluate the effects of delta9-tetrahydrocannabinol (delta9-THC) on exploratory behaviour and memory, independent of its locomotor suppressive effects. Dopamine (DA) and noradrenaline (NA) contents were determined in the areas of the brain directly related to such behaviours (hippocampus, striatum and amygdala). An acute dose of delta9-THC led to a decrease in exploratory parameters and motor activity during the holeboard test. The radial arm maze was used to evaluate the effects of this cannabinoid substance on memory. Animals treated with delta9-THC committed more errors in the maze test compared to control, particularly when the retention process was put to test. Furthermore, treatment with delta9-THC led to reduced NA contents in the hippocampus and increased DA contents in the amygdala, without changes in the striatum.

show abstract

“…Potent cannabinoid receptor agonists (for review, see Pertwee 1997) and a potent and selective CB 1 receptor antagonist, SR141716 (Rinaldi-Carmona et al 1994), and a CB 2 receptor antagonist, SR144528 (Rinaldi-Carmona et al 1998), have been described as well. Recently, CB 1 -receptor-mediated inhibition of acetylcholine release in superfused rat hippocampal slices (Gifford and Ashby 1996;Gifford et al 1997) and inhibiton of noradrenaline release in superfused human and guinea-pig hippocampal slices (Schlicker et al 1997) have been shown.…”

Section: Introductionmentioning

confidence: 97%

CB1 receptor density and CB1 receptor-mediated functional effects in rat hippocampus are decreased by an intracerebroventricularly administered antisense oligodeoxynucleotide

Kathmann

Bauer

Schlicker

1999

Naunyn-Schmiedeberg's Arch Pharmacol

Self Cite

View full text Add to dashboard Cite

We have studied (i) the effect of antisense oligodeoxynucleotides complementary to CB1 mRNA on the CB1 receptor binding in hippocampus, striatum and cerebral cortex of the rat; (ii) the possible mechanism of action of one of the antisense oligodeoxynucleotides; and (iii) its effect on two functional CB1 receptor-mediated effects. Synthetic oligodeoxynucleotides or saline were administered to male Wistar rats by the intracerebroventricular (i.c.v.) route twice daily for 3 days. Antisense oligodeoxynucleotides corresponding to the nucleotides 4 to 21 (AS1; GCCATCTAGGATCGACTT) and -8 to 12 (AS2; GATCGACTTCATAACCTCAG) and a mismatch oligodeoxynucleotide differing from AS1 in 6 positions (MM; TCCAGCTACTATGGACTG) were used. The dissociation constant (K(D)) of rat CB1 cannabinoid receptors, labelled by the radioligand [3H]-SR141716, did not differ in membranes from rats treated with saline, AS , AS2 or MM. The density of receptor binding (Bmax) was reduced by the antisense oligodeoxynucleotides, 10nmol, in the hippocampus (AS 1, -40%; AS2, -20%) and striatum (AS1, -29%; AS2 -6%), but not in the cerebral cortex. When the dose of AS1 was raised to 30 nmol, the reduction of Bmax in the hippocampus and striatum was only marginally increased; a dose of 3nmol of AS1 reduced Bmax in both brain regions by somewhat more than the half-maximum effect. The mismatch oligodeoxynucleotide MM (3-30nmol) did not affect Bmax. In the second part of the study, RNA obtained from the three brain regions of rats pretreated with AS1 10 nmol, MM 10 nmol or saline was analyzed using reverse transcription-polymerase chain reaction of CB1 receptor mRNA and of beta-actin mRNA levels (used as reference value). The ratio of CB1 receptor mRNA over beta-actin mRNA after treatment with AS1 did not differ from the ratios following treatment with saline or MM in the hippocampus, striatum and cerebral cortex. Finally, pretreatment with antisense oligodeoxynucleotide AS1 30nmol attenuated two functional effects via CB1 receptors, i.e., the facilitatory effect of WIN 55,212-2 on [35S]-GTPgammaS binding in rat hippocampus membranes and the inhibitory effect of WIN 55,212-2 on acetylcholine release in rat hippocampus slices. In conclusion, (i) two antisense oligodeoxynucleotides reduce the density of CB1 receptors in the rat hippocampus and striatum after i.c.v. administration. (ii) The effect of the antisense oligodeoxynucleotide AS1 does not appear to be related to breakdown of CB1 receptor mRNA. (iii) Pretreatment with AS1 attenuated the CB1 receptor-mediated effect in two functional models.

show abstract

Cannabinoid CB1 receptor-mediated inhibition of noradrenaline release in the human and guinea-pig hippocampus Naunyn-Schmiedeberg’s Arch Pharmacol (1997) 356:583–589

Cited by 12 publications

References 0 publications

Inhibition of serotonin release in the mouse brain via presynaptic cannabinoid CB1 receptors

Inhibition of serotonin release in the mouse brain via presynaptic cannabinoid CB1 receptors

The effects of acute treatment with Δ9-THC on exploratory behaviour and memory in the rat

CB1 receptor density and CB1 receptor-mediated functional effects in rat hippocampus are decreased by an intracerebroventricularly administered antisense oligodeoxynucleotide

Contact Info

Product

Resources

About