Cancer Genome Interpreter annotates the biological and clinical relevance of tumor alterations

Abstract

While tumor genome sequencing has become widely available in clinical and research settings, the interpretation of tumor somatic variants remains an important bottleneck. Most of the alterations observed in tumors, including those in well-known cancer genes, are of uncertain significance. Moreover, the information on tumor genomic alterations shaping the response to existing therapies is fragmented across the literature and several specialized resources. Here we present the Cancer Genome Interpreter New computational tools to support the interpretation of tumor genomes are neededCancer is predominantly a genetic disease, caused by the accumulation of so-called "driver" genomic alterations that confer cells tumorigenic capabilities 1 . Thousands of tumor genomes are sequenced every year in research projects and clinical settings around the world. In some cases the whole-genome is sequenced while other focus on the exome or a panel of selected genes. In all cases, the sequencing is followed by the necessity to annotate which of the somatic mutations identified have a possible role in tumorigenesis and treatment response. We call this process 'the interpretation of cancer genomes' and it is currently a tedious .

Whole genome sequencing of melanomas in adolescent and young adults reveals distinct mutation landscapes and the potential role of germline variants in disease susceptibility

“…a , n = 25) revealed a high mutation burden (SNV/indels), with a median of 22 protein coding mutations per megabase (Mb) (range, 0.1–298 mutations/Mb), consistent with the levels we have observed in adult cutaneous melanoma (Table 1) . Supporting Information Table I The only BRAF wild‐type patient carried an NF1 mutation (missense, V2471A), however this is predicted to be a passenger mutation by OncodriveMUT . One tumor (MELA_35619) is noteworthy because it harbored >ten times the number of coding mutations than the median of the cohort.…”

“…Somatic variant caller was used to detect variants that are present in both strands of DNA, cumulative depth of 1,000× and a variant frequency of >3%. Subsequent variant call files were annotated using the Cancer Genome Interpreter to filter out polymorphisms and non‐protein affecting mutations …”

“…Subsequent variant call files were annotated using the Cancer Genome Interpreter to filter out polymorphisms and non-protein affecting mutations. 22 Sanger sequencing of TERT promoter PCR amplification and Sanger sequencing of a 474 bp region of the TERT promoter was performed using primers: hTERT_F ACGAACGTGGCCAGCGGCAG and hTERT_R CTGGCGTCCCTGCACCCTGG, as described. 9 The Cancer Genome Atlas data…”

“…9 Supporting Information Table I The only BRAF wild-type patient carried an NF1 mutation (missense, V2471A), however this is predicted to be a passenger mutation by OncodriveMUT. 22 One tumor (MELA_35619) is noteworthy because it harbored >ten times the number of coding mutations than the median of the cohort. The primary melanoma for this case was a thick (Breslow 9 mm), highly mitotic (17 per mm 2 ) nodular melanoma that arose without an associated nevus on the forehead of a 25-yearold male (Supporting Information Fig.…”

“…Melanoma is one of the most common cancers occurring in adolescent and young adults (AYA, aged 30 years or less) in Western countries. Not only does it account for 11% of all cancers in [15][16][17][18][19][20][21][22][23][24][25][26][27][28][29][30] year olds within the United States, it is also the commonest cause of cancer death in this age group. 1,2 AYA patients diagnosed with localized primary melanoma (AJCC Stage I or II) have higher survival rates compared to older adult patients.…”