Calmodulin-like proteins localized to the conoid regulate motility and cell invasion by Toxoplasma gondii

Abstract

Toxoplasma gondii contains an expanded number of calmodulin (CaM)-like proteins whose functions are poorly understood. Using a combination of CRISPR/Cas9-mediated gene editing and a plant-like auxin-induced degron (AID) system, we examined the roles of three apically localized CaMs. CaM1 and CaM2 were individually dispensable, but loss of both resulted in a synthetic lethal phenotype. CaM3 was refractory to deletion, suggesting it is essential. Consistent with this prediction auxin-induced degradation of CaM3 blocked growth. Phenotypic analysis revealed that all three CaMs contribute to parasite motility, invasion, and egress from host cells, and that they act downstream of microneme and rhoptry secretion. Super-resolution microscopy localized all three CaMs to the conoid where they overlap with myosin H (MyoH), a motor protein that is required for invasion. Biotinylation using BirA fusions with the CaMs labeled a number of apical proteins including MyoH and its light chain MLC7, suggesting they may interact. Consistent with this hypothesis, disruption of MyoH led to degradation of CaM3, or redistribution of CaM1 and CaM2. Collectively, our findings suggest these CaMs may interact with MyoH to control motility and cell invasion.

Conditional Knockdown of Proteins Using Auxin-inducible Degron (AID) Fusions in Toxoplasma gondii

“…T. gondii line RH TIR1-3FLAG (genotype: RHΔ hxgprt Δ ku80; TUB1:TIR1-3FLAG, SAG1:CAT ) (Brown et al ., 2017; Long et al ., 2017a)…”

“…Treatment with an auxin ( e.g., 3-indolacetic acid/IAA) activates the SCF TIR1 ubiquitin ligase complex which exclusively targets AID-tagged proteins for ubiquitin-dependent proteasomal degradation (Figure 1). We recently engineered an RHΔ hxgprt Δ ku80 line of T. gondii to stably express TIR1 from Oryza sativa (RH TIR1-3FLAG) (Brown et al ., 2017; Long et al ., 2017a). In this background, we were able to use CRISPR/Cas9 genome editing (Shen et al ., 2014; Sidik et al ., 2014; Shen et al ., 2017) to tag essential T. gondii genes of interest with AID-3HA or mini-AID(mAID)-3HA, regulate their expression with auxin, and identify phenotypes associated with their loss (Brown et al ., 2017; Long et al ., 2017a and 2017b).…”

CRISPR-mediated Tagging with BirA Allows Proximity Labeling in Toxoplasma gondii

“…For example, if the desired protospacer + PAM site is 5′- GCTGGTCTATCGCTAGCTCG AGG , the forward primer would be 5′- GCTGGTCTATCGCTAGCTCG GTTTTAGAGCTAGAAATAGC. Specific examples for individual genes can be found in these recent papers (Brown et al , 2017; Long et al , 2017a and 2017b). …”

“…Our preferred method of detection with LI-COR IR dye secondary antibodies; however, optimal loading conditions may vary depending on detection method. Protocols for detection of epitope tagged proteins in T. gondii have been detailed previously (Brown et al , 2017; Long et al , 2017a and 2017b). …”

“…(2015) adapted BioID for use in T. gondii , identifying several novel protein components of the inner membrane complex (IMC). BioID has since been employed in T. gondii research to identify interactors of kinases (Gaji et al ., 2015), calmodulins (Long et al ., 2017a), and to define the protein repertoire of other cellular compartments including the parasitophorous vacuole (Nadipuram et al ., 2016), sutures of the IMC (Chen et al ., 2017), and the apical complex (Long et al ., 2017b). Here we will describe the protocol for generating a BirA gene fusions using CRISPR/Cas9 tagging (Shen et al ., 2014; Shen et al ., 2017), in vivo BirA biotin labeling and purification of biotinylated proteins from parasites, and identification of captured biotinylated proteins by mass-spectrometry.…”