Caenorhabditis elegans homologue of Fam210 is required for oogenesis and reproduction

Kang, Jing; Zhou, Hengda; Sun, Fengxiu; Chen, Yongtian; Zhao, Jianzhi; Yang, Wei‐Jun; Xu, Suhong; Chen, Caiyong

doi:10.1016/j.jgg.2020.10.008

Cited by 8 publications

(9 citation statements)

References 48 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…C. elegans cct‐4 was knocked out by CRISPR‐Cas9‐mediated knock‐in of a myo‐2 ::GFP marker in the first exon through homologous recombination 28 . Two sgRNAs (CGCGACCGGAAGCCGATTGT and CGGTCGCGAGCGCAATTTCA) targeting the first exon of cct‐4 were designed with the CRISPOR site (http://crispor.tefor.net/) and cloned into a previously modified pDD162 vector 25 . A repair template was generated by replacing the ccdB sequences with two homology arms (595 bp and 665 bp upstream and downstream of the sgRNAs cut sites) in the pDD317 vector (Addgene), which contains a myo‐2p ::GFP marker and a self‐excising cassette (SEC) 28 …”

Section: Methodsmentioning

confidence: 99%

“…To generate the cct‐4p::nls ‐ gfp transcriptional reporter, the 1967‐bp region upstream of the cct‐4 promoter was cloned into pPD95.67 (Addgene). The translational constructs were generated by cloning the gene coding regions into pPD95.75 (Addgene) or a modified pPD95.75 vector, pCeC21, in which GFP was replaced with mCherry 25 . The promoters of dpy‐7 and vha‐6 were used to drive the gene expression in hypodermis and intestine, respectively.…”

Section: Methodsmentioning

confidence: 99%

“…net/) and cloned into a previously modified pDD162 vector. 25 A repair template was generated by replacing the ccdB sequences with two homology arms (595 bp and 665 bp upstream and downstream of the sgRNAs cut sites) in the pDD317 vector (Addgene), which contains a myo-2p::GFP marker and a self-excising cassette (SEC). 28 The sgRNAs and the pDD317 repair template (50 ng/μl for each plasmid) were injected into wild-type N2 worms.…”

Section: Generation Of Transgenic Wormsmentioning

confidence: 99%

“…The translational constructs were generated by cloning the gene coding regions into pPD95.75 (Addgene) or a modified pPD95.75 vector, pCeC21, in which GFP was replaced with mCherry. 25 The promoters of dpy-7 and vha-6 were used to drive the gene expression in hypodermis and intestine, respectively.…”

Section: Generation Of Transgenic Wormsmentioning

confidence: 99%

See 3 more Smart Citations

A genome‐wide CRISPR screen identifies the CCT chaperonin as a critical regulator of vesicle trafficking

et al. 2023

Self Cite

View full text Add to dashboard Cite

Vesicle trafficking is a fundamental cellular process that controls the transport of various proteins and cargos between cellular compartments in eukaryotes. Using a combination of genome‐wide CRISPR screening in mammalian cells and RNAi screening in Caenorhabditis elegans, we identify chaperonin containing TCP‐1 subunit 4 (CCT4) as a critical regulator of protein secretion and vesicle trafficking. In C. elegans, deficiency of cct‐4 as well as other CCT subunits impairs the trafficking of endocytic markers in intestinal cells, and this defect resembles that of dyn‐1 RNAi worms. Consistent with these findings, the silencing of CCT4 in human cells leads to defective endosomal trafficking, and this defect can be rescued by the dynamin activator Ryngo 1–23. These results suggest that the cytosolic chaperonin CCT may regulate vesicle trafficking by promoting the folding of dynamin in addition to its known substrate tubulin. Our findings establish an essential role for the CCT chaperonin in regulating vesicle trafficking, and provide new insights into the regulation of vesicle trafficking and the cellular function of the cytosolic chaperonin.

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Generation Of Transgenic Wormsmentioning

confidence: 99%

Section: Generation Of Transgenic Wormsmentioning

confidence: 99%

See 2 more Smart Citations

A genome‐wide CRISPR screen identifies the CCT chaperonin as a critical regulator of vesicle trafficking

et al. 2023

Self Cite

View full text Add to dashboard Cite

show abstract

“…Currently, the mechanistic role of Fam210b still remains elusive. Interestingly, the model organism C. elegans has a Fam210 homolog, but it does not synthesize heme, excluding the direct role of Fam210 family proteins in regulating heme synthesis [ 131 ].…”

Section: Using Zebrafish To Study Iron and Heme Homeostasis During Erythropoiesismentioning

confidence: 99%

Using the Zebrafish as a Genetic Model to Study Erythropoiesis

Zhang

Chen

2021

IJMS

Self Cite

View full text Add to dashboard Cite

Vertebrates generate mature red blood cells (RBCs) via a highly regulated, multistep process called erythropoiesis. Erythropoiesis involves synthesis of heme and hemoglobin, clearance of the nuclei and other organelles, and remodeling of the plasma membrane, and these processes are exquisitely coordinated by specific regulatory factors including transcriptional factors and signaling molecules. Defects in erythropoiesis can lead to blood disorders such as congenital dyserythropoietic anemias, Diamond–Blackfan anemias, sideroblastic anemias, myelodysplastic syndrome, and porphyria. The molecular mechanisms of erythropoiesis are highly conserved between fish and mammals, and the zebrafish (Danio rerio) has provided a powerful genetic model for studying erythropoiesis. Studies in zebrafish have yielded important insights into RBC development and established a number of models for human blood diseases. Here, we focus on latest discoveries of the molecular processes and mechanisms regulating zebrafish erythropoiesis and summarize newly established zebrafish models of human anemias.

show abstract

Expression and purification of the mitochondrial transmembrane protein FAM210A in Escherichia coli

Hollinger

Awayda

et al. 2023

Protein Expression and Purification

View full text Add to dashboard Cite

Caenorhabditis elegans homologue of Fam210 is required for oogenesis and reproduction

Cited by 8 publications

References 48 publications

A genome‐wide CRISPR screen identifies the CCT chaperonin as a critical regulator of vesicle trafficking

A genome‐wide CRISPR screen identifies the CCT chaperonin as a critical regulator of vesicle trafficking

Using the Zebrafish as a Genetic Model to Study Erythropoiesis

Expression and purification of the mitochondrial transmembrane protein FAM210A in Escherichia coli

Contact Info

Product

Resources

About